1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
N76 [4]
3 years ago
9

Which of the following statements explains how N-formylmethionine (fMet) is only associated with the 5' AUG initiation codon and

not with internal AUG codons, given that methionine in both cases in encoded by an AUG in the mRNA. Select all that apply. Group of answer choices Only fMet-tRNA(fMet) can bind first to the P site in the ribosome. There are more than one tRNA with the 5' CAU 3' anticodon. fMet is always incorporated at interior AUG sites and then deformylated after translation. The N-formyl group attached to methionine prevents fMet from entering interior positions in a polypeptide.
Biology
1 answer:
Scilla [17]3 years ago
6 0

Answer:

  • Only fMet-tRNA(fMet) can bind first to the P site in the ribosome. ( A )
  • There are more than one tRNA with the 5' CAU 3' anticodon. ( B )
  • The N-formyl group attached to methionine prevents fMet from entering  interior positions in a polypeptide. ( D )

Explanation:

The statements that explains how N--formyl methionine (fMet) is only associated with the 5' AUG initiation codon and not with internal AUG codons, given that methionine in both cases in encoded by an AUG in the mRNA are :

Only fMet-tRNA(fMet) can bind first to the P site in the ribosome. ( A )

There are more than one tRNA with the 5' CAU 3' anticodon. ( B )

The N-formyl group attached to methionine prevents fMet from entering  interior positions in a polypeptide. ( D )

While statement C is wrong.

You might be interested in
The body of tapeworm is segmented but it doesnot belong to phylum annelidai why​
Wewaii [24]

Answer:

look

Explanation:

Flatworms, roundworms, and segmented worms are all invertebrates. Some species of each type of worm are free-living, meaning they are not dependent on another organism.Some are parasitic.

Flatworms belong to phylum Platyhelminthes. They do not have a coelom, respiratory system or a circulatory system.Tapeworms flukes are examples of flatworms.

Roundworms are part of the phylum Nematoda. They are bilaterally symmetrical invertebrates.They have a psuedocoelom. Ascaris lumbricodes is the most common human parasite.

Segmented worms are the most complex animals of these three invertebrates. They are placed in Annelida. Segmented worms have a true coelom, a circulatory system and a digestive system.An earthworm is a segmented worm.

7 0
3 years ago
Find newspaper or magazine articles this week about the United Nations. At the end of the week, write a brief summary about the
nikklg [1K]

Answer:

In addition to maintaining international peace and security, the United Nations protects human rights, delivers humanitarian aid, promotes sustainable development and upholds international law.

Explanation:

7 0
2 years ago
What are the characteristics of the vertebrate's nervous systems?
Delicious77 [7]

Answer:

Vertebrates contain nervous system which is highly specialized organ.

Explanation:

The nervous system is the complex system in the vertebrate body which is composed of central nervous system that contain brain,spinal cord and peripheral nervous system which contain cranial nerve, spinal nerve,involuntary nerve etc.

The nervous system contain neurons that mainly transmit signal to the different parts of the body.

The peripheral nervous sytem contain somatic and visceral part.

The grey matter and white matter are the 2 areas in vertebrate nervous system.

6 0
3 years ago
A client has a rash on the arm that has been treated with an antibiotic without eradicating the rash. What type of examination c
galben [10]

Answer:

b. A Wood's light examination

Explanation:

A wood lamp examination is a test that uses ultraviolet light to examined a skin infected with bacteria or fungal infection.

7 0
3 years ago
Communities make up a major component of an ecosystem. true false
Allushta [10]
I  answer is ' True '
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which statements describe the fat molecule in the image? The fat molecule is unsaturated. The fat molecule is a triglyceride. Th
    12·1 answer
  • Monocots and dicots are two groups of _____.
    8·1 answer
  • Select the correct answer from each drop-down menu.
    11·1 answer
  • Botulism and myasthenia gravis are conditions that cause muscle weakness. Which of these statements is NOT true? Botulism and my
    6·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • How is a terrarium similar to a natural ecosystem? how is it different?
    10·1 answer
  • PLEASE HELP! 25 POINTS AVAILABLE!
    7·1 answer
  • Why are covalent bonds form when an electron is completely lost or gained from an atom
    8·1 answer
  • a model of the complex feeding interastiins among organism in a community from producer to decomposers called
    14·1 answer
  • Which statement best describes how organisms use DNA and amino acids to synthesize a protein
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!