False negative is a condition when you got a negative result for a specimen which was positive. To prevent false negative occur, first you need to use golden standard test or a test with high specificity. You can do multiple tests to ensure the specimen is negative and using a positive control to make sure the reagent is still working fine.
A federal government is the type of government that combines aspects of both unitary and confederal government. The United States has a federal government.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
C hope it helps you. Thanks and have a great day
The answer is Cutaneous Respiration. It is respiration through the surface of the skin. Cutaneous Respiration is used to supplement respiration alongside the use of their lungs. Cutaneous respiration<span> occurs primarily as a means of carbon dioxide exchange, with the majority of oxygen exchange occurring in the </span>lungs<span>. Frogs </span><span>take up most of their oxygen through </span>cutaneous respiration<span>, even if they possess </span>lungs<span>.</span>