1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Novosadov [1.4K]
3 years ago
5

What was Officer James Perkins first job and how old was he?

Law
1 answer:
Reptile [31]3 years ago
5 0
In 1775 Perkins first appears in the records of the Royal Navy when he was appointed to the 50-gun HMS Antelope, the flagship of the commander-in-chief of the Jamaica station as an extra pilot.
You might be interested in
Discuss what changes you think typical
7nadin3 [17]

Answer:

The report, Futurology: the new home in 2050, commissioned by the NHBC Foundation, which provides research and guidance to support the house-building industry, looks ahead three decades and foresees radical adjustments to house building design, inspired by new technology, population shifts and climate change. The report suggests that demographic changes, such as a rapid increase in the number of elderly people and the worsening issue of young people unable to afford to leave home, will drive demand for multi-generational accommodation. More homes will be designed with flexible layouts to suit different generations, which can be adapted as families’ needs change. Inspired by the need for more urban housing in already densely populated areas, future design will produce homes with smaller footprints, but with more storeys, using balcony and roof space to provide outdoor space. Architects may draw inspiration from good compact design, such as in boats or caravans, to produce more “micro-living” options for single people. More innovation will be used when designing “third age” homes for people over 65, reflecting demand for accommodation with lifts, level access and communal activities, whilst retaining privacy and a sense of ownership. By 2050, technology will transform homes into collectors and storers of energy, with electricity, now generated by non-fossil fuel, most likely to be used to heat homes and hot water.  Electric cars will be commonplace with every property equipped with a charging point. The future home will manage its energy use from a centralised platform, combining heating, electrical consumption, ventilation and vehicle charging. As energy efficiency becomes ever more important, ideas currently used in workplaces will become standard in home

Explanation:

4 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
On an interstate, how many miles is it between Exit 25 and Exit 55?
Leto [7]

Answer:

D: 30

Explanation:

well exits are 1 mile apart, so 25 + 30 is 55, hence the distance between exit 25 and exit 55 is 30 miles, i hope this helps u!! :D

6 0
2 years ago
Who had jurisdiction in the John Wayne Gacy murders?
MissTica

Answer:

The indictments were in the circuit court of Cook County and he was charged with 33 counts of murder, one count of deviate s assault, and one count of indecent liberties with a child, one count of aggravated kidnapping.

Explanation:

The People of the State of Illinois vs John WG

Chicago

7 0
3 years ago
Anyone who is of sound mind may waive their rights T/F
Andrej [43]

Answer:

i believe its false hope this helps

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Congress has the constitutional power to control the judicial branch by
    14·1 answer
  • What benefits does U.S. Army offer?
    12·1 answer
  • Lethal force is limited to the use of a firearm.<br> A. True<br> B. False
    11·2 answers
  • If a formal complaint is filed against a mortgage lender under the Mortgage Brokers, Lenders, and Servicers Licensing Act, the l
    6·1 answer
  • why wont i level up from ambitious to the next level i have than 500 points and 5 brainliest im super confused
    9·2 answers
  • What are the conflict and consensus paradigms of law?
    7·1 answer
  • Multiple Choice
    8·1 answer
  • 1. Why does the U.S. have a representative government?
    10·1 answer
  • The concept of _________ allows for the limited use of copyrighted material without obtaining permission from the copyright hold
    8·1 answer
  • Which national agency has regulatory authority for domestic and imported animal products such as raw meat and poultry?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!