Answer:
they are so for..
both of them are comprised of similar tissues working together to perform a particular task.
Answer:
Every recognized species on earth (at least in theory) is given a two-part scientific name. This system is called "binomial nomenclature." These names are important because they allow people throughout the world to communicate unambiguously about animal species.
Enzyme-containing laundry detergents will remove stains more effectively than detergents without enzymes. Stains will be removed more successfully from clothing with homemade laundry detergent than from commercial detergents.
A variable that is independent is precisely what it sounds like. It is a stand-alone variable that is unaffected by the other variables you are attempting to assess. Age, for instance, could be an independent variable. A person's age won't alter as a result of other circumstances like what they eat, how much they attend school, or how much television they watch. In actuality, when attempting to establish a link between two variables, you are attempting to determine whether the independent variable affects the dependent variables in any way.
A dependent variable is precisely what it sounds like, just like an independent variable. It is something on which other elements depend. A test score, for instance, maybe a dependent variable because it could vary based on a number of variables, including how much you studied, how much sleep you got the night before the test, and even how hungry you were.
To learn more about the dependent variable here:-
brainly.com/question/1479694?referrer=searchResults
#SPJ9
The study of onion root tips is widely known for the clear appearance of the stages of mitosis since the chromosomes are large and are clearly visible. They are easily stained with the stainer and are visible clearly under the electron microscope. The phase of mitosis are
Interphase
Prophase
Metaphase
Anaphase
Telophase and
Cytokinesis
Each of these phases show the different stages in which the division of one cell into two daughter cells takes place. The cytokinesis is the final phase in the mitosis cell division. This is the part of cell division process during which the cytoplasm of the cell divides into two equal parts and forms into two daughter cells.
During the cytokinesis process, the spindle apparatus partitions and transports the duplicated chromatids and moves into the cytoplasm of the dividing daughter cells. In this process a dividing structure called the cell plate is formed to distinguish the daughter cells. This cell plate later grows into a double layered cell wall which then splits the parent cell into two separate cells.
Hence the option D is the right answer
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
