1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lawyer [7]
3 years ago
13

Flowering plants were most common plant during what era

Biology
1 answer:
Naya [18.7K]3 years ago
8 0

Answer:

Cretaceous

From their earliest diversification in the Cretaceous Period (145 million to 66 million years ago), angiosperms rapidly came to dominate the land flora. Today there are more than 300,000 species of flowering plants, which account for more than 90 percent of the diversity of vascular plants.

You might be interested in
What will happen to a flower garden over time If it’s left unattended
hichkok12 [17]
If it has no water it will start to dry, and if it has no sun it will start to die
5 0
3 years ago
Read 2 more answers
The mother of an infant child asks the nurse what the right feeding schedule is for an infant. Of the following responses, which
lys-0071 [83]

Answer:

B

Explanation:

The child may go through growth spurts at 7-14 days old, between 3-6 weeks old, around 4 months old, and around 6 months old. So feeding them at that consistency will help in their development.

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Hii everyone i have question again which substances made gages​
slamgirl [31]

What is the question???

8 0
3 years ago
select all of the following statements that are true concerning living organisms and how they acquire energy.
Bad White [126]

The statements that are true concerning living organisms and how they acquire energy are;

Cells, the basic unit of life, cannot survive on their own. Instead, all living organisms must obtain and use energy to live.

The daily food consumption of an organism provides the energy to support all the metabolic processes required for the organism to live.

What are Living organisms?

Living organisms can be regarded as organisms that possess characteristics such as the ability to move and reproduce.

However, they acquire useful energy in different ways, and the daily food consumption of an organism provides the energy to support all the metabolic processes.

Learn more about Living organisms at:

brainly.com/question/2673869

#SPJ4

3 0
2 years ago
Other questions:
  • Which of the following is true about skin bones muscles the heart intestines
    7·1 answer
  • Tectonic plate movement is created by
    11·1 answer
  • What's the main purpose of the placenta
    10·1 answer
  • The purpose of the mucus found within the respiratory system is to A. help move air through the windpipe. B. trap particles from
    13·1 answer
  • Mendel's results demonstrated that diploid organisms have phenotypes, whereas haploid organisms have genotypes. phenotype is ind
    11·1 answer
  • PLEASE answer!!!!!!!!!
    13·1 answer
  • 11
    7·1 answer
  • What are the 3 types of plate boundaries? Describe each.
    5·1 answer
  • Which organelle is only
    8·2 answers
  • What adaptations do tree have in the rainforest?​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!