Both seta and cheta or chaete means bristles. I think the term can be used interchangeably . Just check this link:- http://en.wikipedia.org/wiki/Polychaete It about polychaetes a class of annelid worms. These are extracts form the passage:- Each body segment has a pair of fleshy protrusions called parapodia that bear many bristles, called *chaetae, which are made of chitin. Indeed, polychaetes are sometimes referred to as bristle worms. Bundles of bristles, called *setae, project from the parapodia. http://en.wikipedia.org/wiki/File:Polychaeta_anatomy_en.svg Thats a cross section the terms have been used interchangebly.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
1 pretty sure its A and 2 i think its B
Explanation:
Cerebellum smoothes and coordinates the movement of skeletal muscle.
