1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lerok [7]
3 years ago
12

Which describes the struktures shown below the soil line?

Biology
1 answer:
user100 [1]3 years ago
3 0

Answer:

its D

Explanation:

Its D cause plants use their roots to get water and the vascualar tissues are found in the root most of the time.

You might be interested in
All answers but "the blood brain barrier does not factor in with endocrine signaling. " are true.
padilas [110]
Endocrine signaling is hormone based signaling that travels through the blood stream. Many of the sensors and integrating sensors of the endocrine system are located in the brain. The brain barrier contributes to endocrine signalling, such that the brain barrier does not factor in with endocrine signalling. The answer is A
7 0
3 years ago
Read 2 more answers
The producers had 6,000 kcal of energy , how much would be passed to the primary consumer?
morpeh [17]

Answer:

600 kcal

Explanation:

In an ecosystem, energy is transferred from one organism in a trophic level to another organism in another trophic level. Organisms called PRODUCERS are capable of deriving energy from the sun. However, when fed upon by PRIMARY CONSUMERS, only about 10% of the energy is transferred to them because most of the energy (90%) is lost as heat.

Hence, in this case where the producers had 6,000 kcal of energy, 10% i.e. 10/100 of 6000 = 600 kcal of energy will be transferred to the primary consumers.

5 0
3 years ago
Habitat loss is NOT a factor in the decline of pollinator populations.<br> True<br> False
Dennis_Churaev [7]

Answer:false and true

Explanation:

6 0
3 years ago
Read 2 more answers
What structure is found in viruses but not in cells?
meriva

Answer:F

Explanation:

8 0
3 years ago
Deer are eating the crops of local farms. Farm owners are asking wildlife managers to increase the bag limits for deer in the st
Mila [183]
<span>With the deer population down because many are killed, insects and ticks will starve. With less bugs, the lizards and frogs will have less to eat which means their population would lower as well.As their population lowers the population of their consumers will lower too</span>
3 0
3 years ago
Other questions:
  • Where are the photoreceptors located inside a human eye
    12·2 answers
  • What type of cell is pictured here? How do you know?
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Are you interested in using genetic screening for yourself or for your future children? Why or why not??
    7·2 answers
  • How does the zygosporangium of Rhizopus stolonifer function to ensure the survival of the species? A: It breaks down complex mat
    10·1 answer
  • What is the function of NADH?
    5·1 answer
  • Which widely used system of government did ancient Greece contribute to the modern world? A. democracy B. monarchy C. republican
    6·2 answers
  • What is the essence of the catalase test?
    15·1 answer
  • Selective Breeding can have both pros and cons. For example, you can achieve a ‘desirable’ look of the breed that you want. Howe
    6·1 answer
  • What affect does the properties of water have on Earth's surface and its systems?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!