1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leviafan [203]
3 years ago
9

What is responsible for abo blood types

Biology
1 answer:
lara31 [8.8K]3 years ago
6 0
What do you mean by responsible? Do you want to know the genetics behind it, what the surface markers do, or why they are metically important? I think I can help.
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
What are three things that are necessary for yeast to grow?
just olya [345]
PH Level, and food source such as sugar.


5 0
3 years ago
Explain how a recessive trait is passed onto offspring.
juin [17]
It can be passed down heck anything can be passed down it all has to do with your parent's genes
 
7 0
3 years ago
GgBb _grey fur and black eyes.
gizmo_the_mogwai [7]

Answer No 4:

The possible gametes for a homozygous grey furred and homozygous black eyed rabbit will be GGBB.

Answer No 3:

The possible gametes for a heterozygous grey furred and heterozygous black eyed rabbit will be GgBb.

Answer No 4:

The possible gametes for a heterozygous grey furred and red eyed rabbit will be Ggbb.

Answer No 5:

The possible gametes for a white furred and heterozygous black eyed rabbit will be ggBb.

5 0
3 years ago
What is true of renewable resources? A) They may be used up if consumption continues at its current rate. B) They are only found
igor_vitrenko [27]

C) because solar, wind, hydro, geothermal, biomass, ocean are all was thaer

4 0
3 years ago
Read 2 more answers
Other questions:
  • Often the second part of a scientific name is
    14·1 answer
  • Why is commensalism important? Why is it necessary for ecosystem?
    7·1 answer
  • Which are homogeneous mixtures? Check all that apply.
    14·2 answers
  • Which of these is a biotic factor of an ecosystem?
    7·2 answers
  • What is the primary function of a fruit?
    8·1 answer
  • Example of adaptation
    8·1 answer
  • Can carbon atoms bond with other atoms to form long chains?
    11·2 answers
  • This was used to print bank notes by the japanese​
    9·1 answer
  • Explain energy flow from producer to consumer.
    7·1 answer
  • What do scientists call a region of Earth that contains an unusually large number of species that are threatened by habitat loss
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!