1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ipn [44]
3 years ago
14

Comparable segments of the mitochondrial DNA sequences of two similar species are shown below. This segment of DNA mutates at a

rate of one base pair per 33 million years. Based on these DNA sequences, how long ago did the two species diverge from a common ancestor?
Species A mtDNA sequence: TACAAGATAC
Species B mtDNA sequence: TACGCGTAAC
99 million years ago
33 million years ago
66 million years ago
132 million years ago
Biology
2 answers:
Gnom [1K]3 years ago
5 0

Answer:

132 million years ago

Explanation:

The two DNA mit have a difference of 4 bases. If the frequency of mutation is one every 33 million years. We can stipulate that the time that has passed since the two species diverged from a common ancestor is 132 million years. This can be calculated by multiplying the number of variations by the frequency.

4 (variations) x 33 million years = 132 million years.

Species A mt DNA :  TACAAGATAC

Species B mtDNA:    TACGCGTAAC

tangare [24]3 years ago
4 0
99million years ago, so the answer is C


You might be interested in
uncontrolled cell division can lead to the formation of masses of cells that can remain in place called ____ tumors or ones that
Juliette [100K]

Answer:

Uncontrolled cell division can lead to the formation of masses of cells that can remain in a place called <u>primary </u>tumors or ones that can move called <u>metastatic </u>tumors.

Explanation:

The term primary tumor refers to the original tumor, a place where the tumor first appeared.

Metastatic tumors are tumors that appear in other organs and originate from the primary tumor. Tumor cells can break away from the primary tumor and travel to other locations in the body through the blood or lymph system and form new tumors. This is how metastatic tumors appear.

For example, a brain tumor is a primary tumor if it first appeared in the brain. A metastatic brain tumor is a tumor that appeared in another organ and then spread to the brain.

3 0
2 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Identify the compound that plants make to store as energy
enyata [817]

Plants store starch which is a complex carbohydrate. This can be broken down into a simple one known as glucose. They then use glucose for energy.

8 0
3 years ago
Read 2 more answers
Which group of reactions is responsible for the synthesis in photosynthesis?
Blizzard [7]
Calvin cycle is responsible.
3 0
3 years ago
Why is it important to keep our water supply clean give 3 sentences ?
Studentka2010 [4]

We require to keep our water supply clean because we imbibe that water. If our water supply wasn't unsullied, we would die of dehydration. Another reason is that without water, all the crops would die and we wouldn't have any aliment to victual and so we would withal die of hunger.

8 0
3 years ago
Other questions:
  • WILL GIVE A BRAINLEST
    6·2 answers
  • Oil spills often kill many plants and animals in the affected area. What is the consequence of these mass die offs?
    15·2 answers
  • Need help <br> Compare cells and label
    5·1 answer
  • A cell whose cytoplasm has a concentration of 0.02 molar glucose is placed in a test tube of water containing 0.02 molar glucose
    14·1 answer
  • What causes an ionic bond
    13·2 answers
  • What is the difference between a virus and bacteria in causing infection?
    13·1 answer
  • Describe the most significant restriction on access to potable water around the world.
    5·1 answer
  • can someone give me research to show that both environmental and genetic factors lead to the development of the common cold? due
    13·1 answer
  • There is a genetic trait called sun sneezing when sufferers from ACHOO syndrome sneeze uncontrollably when exposed to direct sun
    11·1 answer
  • What happens to energy from the sun as it travels
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!