Answer:
Uncontrolled cell division can lead to the formation of masses of cells that can remain in a place called <u>primary </u>tumors or ones that can move called <u>metastatic </u>tumors.
Explanation:
The term primary tumor refers to the original tumor, a place where the tumor first appeared. 
Metastatic tumors are tumors that appear in other organs and originate from the primary tumor. Tumor cells can break away from the primary tumor and travel to other locations in the body through the blood or lymph system and form new tumors. This is how metastatic tumors appear.
For example, a brain tumor is a primary tumor if it first appeared in the brain. A metastatic brain tumor is a tumor that appeared in another organ and then spread to the brain.
 
        
             
        
        
        
Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA    ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON          UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA    TTTACGGCCATCAGGCAATACTGG
- mRNA     AAAUGCCGGUAGUCCGUUAUGACC
- CODON          AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
 
        
             
        
        
        
Plants store starch which is a complex carbohydrate. This can be broken down into a simple one known as glucose. They then use glucose for energy. 
 
        
                    
             
        
        
        
Calvin cycle is responsible.
        
             
        
        
        
We require to keep our water supply clean because we imbibe that water. If our water supply wasn't unsullied, we would die of dehydration. Another reason is that without water, all the crops would die and we wouldn't have any aliment to victual and so we would withal die of hunger.