1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Assoli18 [71]
2 years ago
14

Identify the locations within the human body for Hyaline, Elastic and Fibrocartilage.

Biology
1 answer:
belka [17]2 years ago
4 0

Answer:

A flexible connective tissue, known as cartilage varies from bones in many ways, its microcomposition is less developed in comparison to the bone and is avascular. It is not supplied with nerves and thus depends upon the process of diffusion to attain nutrients. The three kinds of cartilage are fibrous, hyaline, and elastic.

Of these the most widespread kind is the hyaline cartilage, it looks like glass. It is witnessed in embryos, where the formation of bone takes place as hyaline cartilage, which ossifies later. In adults, it is found on the tips of the ribs, on the articular surfaces of the long bones, the parts of the skull, and the rings of the trachea.

Fibrous cartilage is witnessed in the pubic symphysis and intervertebral discs and exhibits many collagen fibers.

Elastic cartilage is witnessed in the internal support of the external ear and the epiglottis and is yellow, springy, and elastic in characteristics.

You might be interested in
How might optimization be expressed in older adults' sexual activity?
ra1l [238]

Optimization refers to the activity of making the most or best efficient use of a resource of situation. Optimization suggests that it is probable to sustain performance in some areas via spontaneous practice and the application of new technology.  

The older adults get involved in numerous sexual activities, companionship is essential to age individuals. The optimization in older adults’ sexual activity can be expressed by getting involved in more kissing, cuddling, and fantasizing in comparison to intercourse for satisfying the sexual activity.  


7 0
3 years ago
Why is the axis important for seasons?
Bezzdna [24]
If the earth wasn't spinning , we wouldn't have summer, winter, fall, spring etc, it is important because we need the sun for certain seasons and no sun for others. 
6 0
3 years ago
Niclosamide prevents ATP generation in mitochondria. You would expect this drug to be effective against _____. a) Mycobacterium
AlexFokin [52]

Answer:

Helminths

Explanation:

Niclosamide is an anti-helminth drug. It works by inhibiting ATP generation in the mitochondria. ATP which is a major source of energy for cellular organisms is deficient thereby hindering or stopping metabolic processes and then death. Helminths in which Niclosamide is effective against include Pin worm, Round wo,Beef tapeworm( Taenia saginata) etc. The drug is taken orally.

6 0
3 years ago
Read 2 more answers
Geologist have divided earth history into time unit what are largely based on
lesya692 [45]
Geologists have divided the earth history into time units that are largely based on the earth's biotic composition. The modern geological time scale includes both relative and absolute age dating and represents the most up-to-date assessment of the earth's history. In the modern geological time scale, the eras in earth's history when the planet was populated with advanced life forms are referred to as the Paleozoic (meaning ancient life), the Mesozoic (meaning middle life), and the Cenozoic (meaning recent life).
6 0
3 years ago
Substances that are considered neutral have a ph of:
lutik1710 [3]
7.
\\  \\
8 0
3 years ago
Other questions:
  • How can you tell if a somatic cell is from a male or a female?
    8·1 answer
  • Any environmental resource that, because it is scarce or at unfavorable levels, restricts the ecological niche of an organism is
    6·1 answer
  • Quick is de word...<br>taking yuh less than a min...<br>​
    10·1 answer
  • A student collected the above data for this experiment. What error did he make? Explain. Mass of the Graduated Cylinder
    7·2 answers
  • When cells perform photosynthesis, they transform energy from one form to another. Which of the following takes place during pho
    6·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which system does the thyroid gland use te distribute information to the cells of body
    15·2 answers
  • What are the Rod shaped bacterias​
    6·1 answer
  • Please help me im stuck on this its science
    15·2 answers
  • Which of the following best describes how scientists
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!