1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Illusion [34]
3 years ago
10

List the Phase changes that absorb (take in) energy. PLEASE ANSWER! WORTH 12 POINTS!

Biology
1 answer:
Assoli18 [71]3 years ago
3 0

Answer:

  1. melting
  2. evaporation
  3. sublimation

They absorb (Take in) energy but also require energy to be put into effect.

You might be interested in
Which is a density dependent factor?
givi [52]
Water supplies

I think
3 0
3 years ago
how does the gravitational force between two objects change if the distance between the objects increases?
zvonat [6]

Answer:

YES

Explanation:

As g ∝ 1/d² between two two components, further potential difference would result in lower gravitational pull. So the influence of gravitational pull among them also reduces as two things are isolated from the others.

5 0
2 years ago
High metamorphism ( what is the metamorphic rock) ?
vladimir2022 [97]

Answer:

I hope this helps you!

Explanation:

Metamorphic rocks started out as some other type of rock, but have been substantially changed from their original igneous, sedimentary, or earlier metamorphic form. Metamorphic rocks form when rocks are subjected to high heat, high pressure, hot mineral-rich fluids or, more commonly, some combination of these factors

4 0
2 years ago
Read 2 more answers
What is the fate of most solar energy when it enters Earth’s atmosphere?
drek231 [11]
C, it is absorbed by earths surface.

5 0
3 years ago
Read 2 more answers
The image shows a magnified view of a leaf's surface with the stomata visible. What’s the significance of these structures in th
laiz [17]

Answer:

The correct answer is option C. They absorb water vapor from the atmosphere, providing water to the plant for photosynthesis.

Explanation:

Stomata are small opening present on the lower side of leaf. Its main function is to exchange of gases that are required for the process of photosynthesis. During day time, stomata are open and carbondioxode which is a raw material used for the production of glucose is absorbed from air and oxygen is released in the atmosphere.

5 0
2 years ago
Read 2 more answers
Other questions:
  • Gamma-aminobutyric acid (gaba) appears to decrease synaptic transmission and seems related to _______ drugs.
    15·1 answer
  • Earth scientists study the history of the earth. What are some ways that they determine the age of the earth or geologic feature
    11·1 answer
  • What does a fossil of an ancient shark in Kansas indicate?
    12·2 answers
  • 1. Plants are considered living because
    12·2 answers
  • Red/green color blindness in humans is caused by an X-linked recessive allele. If a male who is affected by the condition mates
    10·1 answer
  • What are the harmful effects of pizza?
    14·1 answer
  • Charles Darwin made famous observations of finches on islands in the Pacific Ocean. The birds were believed to have come all fro
    11·2 answers
  • What are the applications of Bone Marrow Cells?
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Gentoo penguins present a potential mate with a pebble. Emperor penguins have a specific call and movement that they make to att
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!