1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
15

when running a gel you need to have a positive control and negative control. what do these mean and what are they each used for?

Biology
1 answer:
Makovka662 [10]3 years ago
3 0
I believe the positive control receives a treatment with a known response, so that this positive response can be compared to the unknown response of the treatment. This is used in electrophoresis to compare the DNA strands to the DNA standard. The negative control is used when no response is expected, which is also used in the process of electrophoresis. Electrophoresis is a technique used in laboratories  in order to separate macromolecules based on size. It applies a negative charge so proteins move towards a positive charge. It is sued for the analysis of both DNA and RNA. 
You might be interested in
Identify which organisms can be infected by viruses. Choose one or more: A. Protists B. Bacteria C. Animals D. Plants E. Fungi F
svlad2 [7]

Answer:A. Protists B. Bacteria C. Animals D. Plants E. Fungi F. Archaea

Explanation:viruses are small non-living particles that contains hereditary materials.viruses attack cells of other organisms such as plants , bacteria ,archaea etc.

Viruses are acellular and contains either DNA or RNA.they cannot synthesis protein as they lack ribosomes ,so they use the ribosomes of the cell they have invaded to synthesize they proteins they need.

A virus usually has a central core surrounded by an outer protein coat called capsid.

Viruses can reproduce only within the living host cells and they are specific to the type of cells they attack.they attack plants through insect vectors or through openings on the plants.

Viruses can affect bacteria by injecting their nucleic acids through the cell wall and into the bacteria cell.such viruses are called bacteriophages.

6 0
3 years ago
An example of a biological event that follows a circadian rhythm is:
nikitadnepr [17]
Sleep is an example. 
Circadian rythms are biological processes that repeats itself within a certain time frame, as sleep repeats itself approximately once every day. 
3 0
3 years ago
Determination of Caloric Content of Three Foods1. Compare the calorimeter that you built to a bomb calorimeter. How are they sim
yulyashka [42]

Answer:

The answers to both parts (1 and 2) are given below.

Explanation:

1. The calorimeter is similar to the bomb calorimeter in a way that both measure the changes in heat that occur as result of the chemical reaction taking place inside them. They are different in the sense that a bomb calorimeter provides an isolated system with constant volume and pressure, whereas a regular calorimeter allows pressure to equalize with the environment.

2. Carbohydrates are the molecules that break down and provides energy for cellular functions. Whereas, proteins are not meant for the production of energy but for the production of amino acids to function as structural units for protein synthesis. Simply, the breakdown of protein is for the synthesis of more proteins by providing several units of amino acids rather than the production of energy.

5 0
3 years ago
The health of coral reefs depend on several factors. One is clean water. Erosion on land causes rivers to dump mud on reefs, smo
snow_lady [41]

Answer:

D) When corals are babies floating in the plankton, fish swim with them and protect them from harm.

Explanation:

This is the statement that does not explain how fish and coral relate to one another. It is false that when corals are babies, fish swim with them and protect them. However, the rest of the statements are true. It is true that fish eat predators, and that they also eat seaweed and kelp that could smother the coral. Finally, it is also true that some fish live symbiotically with coral, luring prey for the coral to kill and eat.

7 0
3 years ago
Can you tell the difference between electromagnetic and mechanical waves?
mart [117]

Answer:

Electromagnetic waves can travel through a vacuum, that is an empty space, whereas mechanical waves cannot. They need a medium to travel such as water or air. Ripples in a pond are an example of mechanical waves whereas electromagnetic waves include light and radio signals, which can travel through the vacuum of space.

Explanation:

8 0
3 years ago
Other questions:
  • Does the cell cycle have a beginning and an end
    5·1 answer
  • The species that are most vulnerable to extinction are those, which are
    10·1 answer
  • How do gastropods function as decomposers?
    14·1 answer
  • One reason tundra plants are small and grow close to the ground is that _____.
    9·1 answer
  • PI 3-kinase:_________
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which statement best explains why herbivores are not considered parasites? A. They do not harm the plants they eat. B. They do n
    13·2 answers
  • HELP answer only if 100% sure you think that is the correct answer.
    13·1 answer
  • Hope you guys anwser fast!!!
    11·1 answer
  • The production of orchids by cutting is an example of______.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!