1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nataly_w [17]
2 years ago
12

How many grams of the parent isotope are left in the sample after three half lives?

Chemistry
1 answer:
pochemuha2 years ago
5 0
After 3 half-lives, 125 grams of the parent isotope will remain.
You might be interested in
Sodium-potassium pumps are examples of what type of cellular transport?
Dmitrij [34]

Answer:

Active transport

Explanation:

Sodium-potassium pumps are examples of Active type of cellular transport. Sodium potassium pump exchanges sodium ions from potassium ions through the plasma membrane of animal cells.

Whereas Active transport can be defined as movement of ions and molecules across a cell membrane to the region  of higher concentration with the help of enzymes and energy.

5 0
3 years ago
The decomposition of nitrogen dioxide is described by the following chemical equation: Suppose a two-step mechanism is proposed
Mandarinka [93]

Answer:

<u>first step </u>

NO2(g)  ------------------------------------> NO(g) + O(g)

<u>second step</u>

NO2(g) + O(g) -----------------------------> NO(g) + O2(g)

Explanation:

<u>first step </u>

NO2(g)  ------------------------------------> NO(g) + O(g)

<u>second step</u>

NO2(g) + O(g) -----------------------------> NO(g) + O2(g)

8 0
3 years ago
What volume of o2 is needed to react fully with 720. Ml of nh3
Galina-37 [17]

Ammonia undergoes combustion with oxygen to produce nitric oxide and water. The volume of the oxygen required to react with 720 ml of ammonia is 900 ml.

<h3>What is volume?</h3>

Volume is the area occupied by the substance and is the ratio of the mass to the density.

At STP, 1 mole of gas occupies 22.4 L of volume

Given,

Volume of ammonia reacted = 0.720 L

The combustion reaction is shown as,

\rm 4NH_{3} + 5O_{2} \rightarrow 4NO +6H_{2}O

From the stoichiometry of the reaction, it can be said that,

(4 \times  22.4) L of ammonia reacts with (5 \times  22.4) L of oxygen gas.

So, 0.720 L of  ammonia will react with:

\dfrac{ (5 \times  22.4)}{(4 \times  22.4)} \times 0.720 = 0.9 \;\rm L

Therefore, the volume of oxygen required is 900 mL.

Learn more about volume here:

brainly.com/question/14090111

#SPJ4

6 0
2 years ago
What noble gas has the same electron configuration as the oxide ion?
Tems11 [23]
I love these type of questions :)

Final Answer: Neon
5 0
3 years ago
How does increasing the temperature affect collisions?
ddd [48]
Combustion Have a great day!
8 0
2 years ago
Read 2 more answers
Other questions:
  • Explain the changes that take place at the molecular level when a substance is superheated or supercooled ?
    13·1 answer
  • Pls help :(
    6·2 answers
  • What is the volume of 8.50 moles of hydrogen gas?
    10·1 answer
  • A 25.0 ml sample of an unknown monoprotic acid was titrated with 0.12 m naoh. the student added 31.6 ml of naoh and went past th
    5·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Which layer of earth has the greatest pressure?
    13·1 answer
  • How many grams of a precipitate are formed after mixing 10.0 mL of a 1.30 M solution of sodium sulfate with 20.0 mL of a 1.10 M
    7·1 answer
  • Bored fr so so bored anyone at all wanna hang only if your from14-16
    13·2 answers
  • Imagine you are about to investigate what happens when sodium and potassium are mixed together. Before you begin your experiment
    14·1 answer
  • Find the mole fraction of benzene and toluene in solution containing​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!