1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
2 years ago
10

Which explains how the nervous system is typically involved in keeping the body in homeostasis?

Biology
1 answer:
ohaa [14]2 years ago
8 0
The nervous system gives us reactions to dangerous systems, such as when you touch a hot stove you pull your hand back quickly. This shows homeostasis because the body is able to stay stable by preventing pain.
You might be interested in
Qué son las bases nucleotídicas
shusha [124]

Answer:

Un nucleótido es el componente básico de los ácidos nucleicos. ... Un nucleótido consiste en una molécula de azúcar (ribosa en el ARN o desoxirribosa en el ADN) unida a un grupo fosfato y una base que contiene nitrógeno. Las bases utilizadas en el ADN son adenina (A), citosina (C), guanina (G) y timina (T).

Explanation:

8 0
3 years ago
Which is the smallest unit of life?
zysi [14]

Answer:

D, cells.

Explanation:

7 0
3 years ago
Read 2 more answers
In what year did the goverment introduce a strict cleaning program for the hospitals
Jet001 [13]
It became clear in the 1970's


7 0
3 years ago
Pluto is not a planet because it does not have its own orbit. Which planet's orbit does it cross? Why will they never collide?
ratelena [41]
Hey there!

Pluto crossed Neptune's orbit. However, their paths do not actually cross, they just swap positions. 

Hope that helps!

~Autumly

5 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Which mineral test is shown in the image below
    10·2 answers
  • Which of the following describes catabolic reactions?
    14·1 answer
  • Fill in the with what each type of organic compound is made up of.
    13·2 answers
  • All but one of the girl's traits are determined by her chromosomes. that is
    14·2 answers
  • What is a pheromone?
    8·2 answers
  • What are the products of the light-dependent reactions?
    6·1 answer
  • The role of enzymes in seed germination​
    9·1 answer
  • You wanted to prepare a fish dish for your grandfather that he loves the dried salted Codfish. But
    5·1 answer
  • How does an iron nail change after being exposed to the oxygen in the air over a long time? Question 24 options: It burns It dec
    9·1 answer
  • Why is an animals cell that is surrounding by freshwater likely to burst?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!