1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
7

Claims • Evidence • Reasoning Make a claim about how the energy of a microwave compares to the energy of a gamma ray. Summarize

evidence to support your claim and explain your reasoning.
Biology
1 answer:
pishuonlain [190]3 years ago
4 0

Answer:

Today, the consensus among scientists, astronomers and cosmologists is that the Universe as we know it was created in a massive explosion that not only created the majority of matter, but the physical laws that govern our ever-expanding cosmos. This is known as The Big Bang Theory. For almost a century, the term has been bandied about by scholars and non-scholars alike. This should come as no surprise, seeing as how it is the most accepted theory of our origins. But what exactly does it mean? How was our Universe conceived in a massive explosion, what proof is there of this, and what does the theory say about the long-term projections for our Universe? The basics of the Big Bang theory are fairly simple. In short, the Big Bang hypothesis states that all of the current and past matter in the Universe came into existence at the same time, roughly 13.8 billion years ago. At this time, all matter was compacted into a very small ball with infinite density and intense heat called a Singularity. Suddenly, the Singularity began expanding, and the universe as we know it began.

 

Explanation:

You might be interested in
Similar plant and animal fossils
nasty-shy [4]
B. I gives evidence that the continents used to be connected.
4 0
2 years ago
A student completed a lab report. Which correctly describes the difference between the “Question” and “Hypothesis” sections of h
docker41 [41]
The difference between the "Question" and the "Hypothesis" is that a hypothesis is what you believe is the answer to the question based off of limited evidence while the question is just a regular question e.x. (for question) "Why is the water moving to the south?"
then using whatever evidence they will have they would do a hypothesis e.x. (for hypothesis) I believe the water is moving south due to the wind coming down from the north... or due to a current.
8 0
3 years ago
How to treat Zygomycota desease?
zheka24 [161]

Answer:

Zygomycota. It's a fungus and a disease that can be treated, usually, with azoles and echinocandins. You might also need medical debridement. It's part of the infected tissues while being guided by amphotericin B administration.

After the administration, doctors found that Novel azole antifungal could help this disease. Later, it was Isavuconazole. This medicine happened to be recommended for treatment as well.

In non-trauma situations, it usually begins in the nose. It is one of the most rapidly dispersing fungal infections in humans. To treat it, you need a concentrated antifungal drug remedy.

3 0
3 years ago
An rna molecule is looking for a job in a protein synthesis factory. it asks you to write its resume. this rna molecule is not y
Alborosie
<span>For the answer to the question above, the mRNA stands for messenger RNA. The job of the messenger RNA is to copy the code from the DNA and go through a ribosome so a protein can be created.

rRNA stands or ribosomal RNA. It is essentially the ribosome and is comprised of the large and small subunit. The rRNA allows the mRNA to go through rRNA in order to create the amino acid chain.

tRNA stands for transfer RNA. tRNA brings amino acids to the coordinating codon on the mRNA and matches it to the correct codon.
</span>
5 0
3 years ago
When large masses of magma solidify far below Earth’s surface, they form igneous rocks that have a _____.
telo118 [61]

Answer:

coarse-grained texture

Explanation:

Igneous rocks come from magma of volcanos and they cool and end up becoming hard. A perfect example of this is granite, which contains a lot of minerals such as quartz and feldspar. Igneous rocks contain a lot of minerals hence why they have a coarse-grained texture.

Hope this helped :)  

5 0
3 years ago
Other questions:
  • Two tongue-rollers have 12 children. 8 of their children can roll their tongues and 4 cannot. Make an argument about the genotyp
    8·2 answers
  • Why are scientific theories modified
    5·1 answer
  • With the exception of sensory neurons, the role of a neuron's __________ is to carry information toward the cell body, whereas t
    8·1 answer
  • Adaptative features of plant and animal cells
    5·1 answer
  • IMP is the metabolic intermediate where purine biosynthesis branches for synthesis of
    11·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is the genotype of a women who is a carrier heterozygous for color blindness
    15·1 answer
  • What do all of these samples have in common?
    15·2 answers
  • Which of the following are considered disadvantages of an agricultural society?
    11·1 answer
  • Que relación tiene el sistema nervioso con el sistema sexual​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!