1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hoochie [10]
3 years ago
6

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Physics
1 answer:
igor_vitrenko [27]3 years ago
7 0

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

You might be interested in
A fox runs at a speed of 16 m/s and then stops to eat a rabbit. If this all took 120
GalinKa [24]

Answer:

a = 52s²

Explanation:

<u>How to find acceleration</u>

Acceleration (a) is the change in velocity (Δv) over the change in time (Δt), represented by the equation a = Δv/Δt. This allows you to measure how fast velocity changes in meters per second squared (m/s^2). Acceleration is also a vector quantity, so it includes both magnitude and direction.

<u>Solve</u>

We know initial velocity (u = 16), velocity (v = 120) and acceleration (a = ?)

We first need to solve the velocity equation for time (t):

v = u + at

v - u = at

(v - u)/a = t

Plugging in the known values we get,

t = (v - u)/a

t = (16 m/s - 120 m/s) -2/s2

t = -104 m/s / -2 m/s2

t = 52 s

7 0
3 years ago
A force of 5N produces an acceleration of 8m/s2 on mass m1, and an acceleration of 24m/s2 on a mass m2. What acceleration would
kotykmax [81]

The acceleration that the same force will provide if both masses are tied together is; 6.0 m/s².

<h3>How to find the Acceleration?</h3>

We are given;

Force; F = 5 N

Acceleration of the first mass, a₁ = 8.0 m/s²

Acceleration of the second mass, a₂ = 24 m/s²

Formula for force is;

F = ma

Let us find both masses; m₁ and m₂.

m₁ = F/a₁

m₂ = F/a₂

Thus;

m₁ = 5/8 kg

m₂ = 5/24 kg

Total mass is; m = m₁ + m₂

m = 5/8 + 5/24

m = 15 + 5/24

m = 20/24 kg

Thus, acceleration if they are both tied together is;

a = F/m

a = 5/(20/24)

a = 6.0 m/s².

Read more about Acceleration at; brainly.com/question/605631

#SPJ1

4 0
2 years ago
Cientists have changed the model of the atom as they have gathered new evidence. One of the atomic models is shown below.
scZoUnD [109]

Answer:

A few of the positive particles aimed at a gold foil seemed to bounce back.

Explanation:

3 0
3 years ago
On the modern periodic table, elements are ordered according to what?
sweet [91]

The periodic table of elements arranges all of the known chemical elements in an informative array. Elements are arranged from left to right and top to bottom in order of increasing atomic number. Order generally coincides with increasing atomic mass. The rows are called periods.

6 0
3 years ago
A 2.0 kg sphere with a velocity of 6.0 m/s collides head-on and elastically with a stationary 10 kg sphere
dmitriy555 [2]

Question: A 2.0 kg sphere with a velocity of 6.0 m/s collides head-on and elastically with a stationary 10 kg sphere, What is thier velocities after collision.

Answer:

v = 6 m/s, v' = 0 m/s

Explanation:

From the question,

For Elastic collision,

mu+m'u' = mv+m'v'......................... Equation 1

Where m = mass of the first sphere, m' = mass of the second sphere, u = initial velocity of the first sphere, u' = initial velocity of the second sphere, v = final veolocity of the first sphere, v' = final velocity of the second sphere.

Also,

The relative velocity before collision = relative velocity after collision

u-u' = v-v'............................ Equation 2

Given:  m = 2 kg, m' = 10 kg, u = 6 m/s, u' = 0 m/s

Substitute into equation 1 and 2

2(6)+10(0) = 2v+10v'

2v+10v' = 12.............. Equation 3

6-0 = v-v'

v-v' = 6 ................... Equation 4

Solve equation 3 and 4 simultaneously.

v = 6+v'............. Equation 5

Substitute equation 5 into equation 3

2(6+v')+10v' = 12

12+2v'+10v' = 12

12v' = 12-12

v' = 0/12

v' = 0 m/s.

Also substitute the value of v' into equation 5

v = 6+0

v = 6 m/s

5 0
3 years ago
Other questions:
  • Light with an intensity of 1 kW/m2 falls normally on a surface with an area of 1 cm2 and is completely absorbed. The force of th
    11·1 answer
  • Consider that a ray of light is travelling from glass to water. The refractive index of water is 1.30 (i e n . ., 1.30 w = ) and
    14·1 answer
  • How is thermal energy transferred?
    13·2 answers
  • You have a circuit with a 50 Ω , a 100 Ω , and a 150 Ω - resistor connected in series. (a) Rank the current through them from hi
    13·1 answer
  • A rocket, initially at rest, is fired vertically with an upward acceleration of 10 m/s2. At an altitude of 0.50 km, the engine o
    8·1 answer
  • What is 1960 in scientific notation
    6·1 answer
  • The diagram shows the Earth rotating on it's axis. The two star symbols show different locations on the surface... What would th
    8·2 answers
  • Is it possible to round a corner with a constant speed and a constant velocity
    9·1 answer
  • What can i yeet baby or toddler
    13·1 answer
  • What is comma please plz me.!!​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!