4 years ago

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Physics

1 answer:

igor_vitrenko [27]4 years ago

7 0

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

You might be interested in

When the ultrasound beam strikes the surface at or nearly at right angles, the fraction of sound energy that is reflected (R) at

lyudmila [28]

Explanation:

<h2>the expression of x= -4t+2t^2 where x is displecement?</h2>

7 0

3 years ago

You are a nurse in a hospital. You are told to move a patient through three corridors each measuring 14.33 meters. Because of fr

dimulka [17.4K]

Work done by force is given by formula

$W = F.d$

now here work done against friction is given so force of friction here is

$F_f = 848 N$

It moved by three corridors with each measures

$d = 14.33 m$

so total distance will be

$s = 14.33 \times 3 = 43 m$

now from above formula of work done we will say

$W = 848 \times 43$

$W = 36464 J$

so above is the work done to move three corridors

3 0

3 years ago

List the levels of classification in order from most broad (largest number of organisms) to most specific (smallest number of or

Tju [1.3M]

Every organism may classified into seven level of classifications, such that each level contains organisms with similar characteristics. Kingdom is the largest and the broadest level of classification while species is the smallest and most specific level of classification. Therefore from the largest to the smallest the order is as follows:
Kingdom
Phylum
Class
Order
Family
Genus
Species

3 0

4 years ago

Read 2 more answers

A rock at rest falls off a tall cliff and hits the valley below after 3.5s. What is the rocks velocity as it hits the ground

pogonyaev

T = 3.5 secs

Velocity (v) = g * t = 10 m/s^2 * 3.5 sec = 35 m/s

7 0

4 years ago

Read 2 more answers

Calculate the current passing through a conductor of resistance 4ohms. If a potential difference of 15V its ends______

statuscvo [17]

Explanation: