1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hoochie [10]
3 years ago
6

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Physics
1 answer:
igor_vitrenko [27]3 years ago
7 0

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

You might be interested in
What is the acceleration of a ball traveling horizontally with an initial velocity of 20 meters/second and, 2.0 seconds later, a
skad [1K]
The answer would be a=5 m/s^2
I hope this helps you, have a great day!
8 0
3 years ago
Read 2 more answers
If the angle of incidence of a light source to a shiny surface is 30 degrees, what will the angle
Virty [35]
<h3>Answer: D) 30</h3>

Angle of incidence always equals angle of reflection. Think of a tennis ball being hit into a wall. The ball will bounce off at the same angle that it approached with. The angles mentioned are formed through the line called the "normal", which is the line perpendicular to the surface.

5 0
3 years ago
Read 2 more answers
Doe anyone get this ​
8_murik_8 [283]

Answer:

we know a = F/ M

Explanation:

  • 2 m/s²
  • 0.19 m/s²
  • 9.25 m/ s²
  • 0.04 m/s²
  • 100.39 m/s²

4 0
3 years ago
Wich usage of water uses the least amount in a year in the united states
Lapatulllka [165]

Live Stock because in 2010 live stock used 10,000 millions gallons of water per day but everything else was higher and irrigation is the highest with 115,000 million gallons per day.

6 0
3 years ago
Read 2 more answers
A can of soup is begin heated in a sauce pan. as the soup is heated, the warm fluid becomes less dense and rises, while the cool
Alexxandr [17]
It is c convection because convection is when something is hot therefore less dense material to rise and cooler material to sink under the influence of gravity
8 0
3 years ago
Other questions:
  • When he sees teachers encouraging other children to wait in the cafeteria until the first bell rings, Ian follows them. What typ
    9·1 answer
  • Which characteristics of Earth’s orbit are in agreement with Kepler’s second law? Check all that apply.
    14·2 answers
  • A 200 g air-track glider is attached to a spring. The glider is pushed in 9.8 cm against the spring, then released. A student wi
    5·1 answer
  • a pennyfarthing is a style of a bicycle with a very large front wheel and a small real wheel, the cyclist who sit high above and
    10·1 answer
  • A satellite is orbiting the Earth in a circular orbit of radius r. Its frequency is independent of its height above the surface
    13·1 answer
  • Put them in order need help plz
    10·2 answers
  • A student creates a model by placing raisins in bread dough and allowing the dough to rise for several hours. The student sketch
    15·1 answer
  • What is the main pathway by which energy is wastefully transferred from a light bulb?
    15·1 answer
  • Forces present on a flying dove
    10·2 answers
  • 21. Explain why a passenger who is not wearing a safety belt will likely hit the windshield in a head-on collision. please answe
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!