All categories

3 years ago

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Physics

1 answer:

igor_vitrenko [27]3 years ago

7 0

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

You might be interested in

After four half-lives of decay, what is the ratio of radioactive parent isotope to stable daughter isotope?

Margarita [4]

Answer:

Ratio of parent to daughter nuclei is 16 : 1

1 : 0.0625

Explanation:

The half of a radioisotope is the time it will take half of the original mass to decay.

Let the original mass be y

After the first half life, the new mass will be y/2

After the second half decay, the new mass will be y/4

After the third half decay, the new mass will be y/8

After the fourth half life decay, the new mass will be y/16.

Thus the ratio of the mother nucleus to the daughter nucleus will be y : y/16

Multiply the ratio through by 16

= 16y : y

= 16 : 1

3 0

2 years ago

What is the kinetic energy of a hammer that starts from rest and decreases its potential energy by 10 kJ?

erma4kov [3.2K]

Answer:

final kinetic energy of the hammer is 10 kJ

Explanation:

As we know that there is no non conservative force on the system

So here we can use the theory of mechanical energy conservation

So we will have

$\Delta K + \Delta U = 0$

here we know that

$\Delta U = - 10 kJ$

from above expression now

$K_f - K_i - 10 kJ = 0$

$K_f - 0 = 10 kJ$

so final kinetic energy of the hammer is 10 kJ

3 0

3 years ago

The International Space Station has a mass of 1.8 × 105 kg. A 70.0-kg astronaut inside the station pushes off one wall of the st

Aleonysh [2.5K]

Answer:

$a = 5.83 \times 10^{-4} m/s^2$

Explanation:

Since the system is in international space station

so here we can say that net force on the system is zero here

so Force by the astronaut on the space station = Force due to space station on boy

so here we know that

mass of boy = 70 kg

acceleration of boy = $1.50 m/s^2$

now we know that

$F = ma$

$F = 70(1.50) = 105 N$

now for the space station will be same as above force

$F = ma$

$105 = 1.8 \times 10^5 (a)$

$a = \frac{105}{1.8 \times 10^5}$

$a = 5.83 \times 10^{-4} m/s^2$

3 0

3 years ago

Two students are watching a person riding a skateboard up and down a ramp. Each student shares what they think about the energy

avanturin [10]

Answer:

Explanation:

We know that , If the frictional force on a system is zero , then the total energy of a system will be conserved.

By using energy conservation

KE₁ + U₁ = KE₂ + U₂

KE₁=Kinetic energy at location 1

U₁ =Potential energy at location 1

KE₂=Kinetic energy at location 2

U₂=Potential energy at location 2

Therefore, Raymond is thinking in a right way.

7 0

2 years ago

Which of theses substances would be a poor conductor of electricity

lys-0071 [83]

Answer:

B. Water and sugar.

Explanation:

In the given options water and sugar would be the poor conductor of electricity. Other given options such as water and salt, water and Hcl and water and NaOH are better conductor of electricity because Hcl ,NaOH, salt (Nacl) can break into their ionic form whereas water and sugar will not.

8 0

3 years ago