1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Hoochie [10]
4 years ago
6

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

Physics
1 answer:
igor_vitrenko [27]4 years ago
7 0

Explanation:

Well A-T have a complementary shape

And C-G have a complementary shape

So replace all Ts for A, and all As for Ts

Replace all Cs for Gs, and all Gs for Cs

You get"

TAACCGGTAACCTTATGGTCAGCTCCGGTGGCTCCGGAATG

You might be interested in
You ride your skateboard to school and tell all your friends you rode at speed of 25 miles per hour
Ray Of Light [21]
And they think you're cool
5 0
3 years ago
Porfavor ayuden que es pa mañana :v
Tpy6a [65]

Answer:

what language is

thattranslate i will.answer then

3 0
3 years ago
The standard measure used to compare sound intensity is the_____
BartSMP [9]
Frequency? Possibly I’m not 100% sure
5 0
4 years ago
If you break quartz to learn if it splits smoothly in a certain direction, what physical property are you testing?
IrinaVladis [17]
Hope this helps!!!!!!!!!!

4 0
3 years ago
Read 2 more answers
During a 0.001 s interval while it is between the plates, the change of the momentum of the electron Δp with arrow is < 0, -8
Delvig [45]

Answer:

5.5 x 10^5 N/C

Explanation:

t = 0.001 s

Δp = - 8.8 x 10^-17 kg m /s

Force is equal to the rate of change of momentum.

F = Δp / Δt

F = (8.8 x 10^-17) / 0.001 = 8.8 x 10^-14 N

q = 1.6 x 10^-19 C

Electric field, E = F / q = (8.8 x 10^-14) / (1.6 x 10^-19)

E = 5.5 x 10^5 N/C

8 0
4 years ago
Other questions:
  • Which numbers on the ph scale indicate an acid
    8·1 answer
  • How do you find the velocity of an object?
    11·1 answer
  • Determine the amount of potential energy of a 5-newton book that is moved to three different shelves on a
    14·2 answers
  • In a single-slit diffraction experiment, the width of the slit through which light passes is reduced. What happens to the width
    15·1 answer
  • A student of mass 63.4 kg, starting at rest, slides down a slide 21.2 m long, tilted at an angle of 26.1° with respect to thehor
    11·1 answer
  • Which rock is made mostly of dark, fine-grained silicate minerals, chiefly plagioclase feldspar and pyroxene, and magnetite?
    5·1 answer
  • What is a type of force that results from turning a corner on a bicycle? ​
    11·2 answers
  • When two plates of the same density collide, what will most likely happen?
    7·1 answer
  • PLEASEE GUYS HELP I BEG YOU
    6·1 answer
  • How can we drop eggs the fewest amount of times without breaking it?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!