1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
2 years ago
10

What happens in people that have this difference in their DNA?

Biology
1 answer:
muminat2 years ago
3 0

Answer:

Explanation:

DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.

Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA

It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.

So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.

You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.

You might be interested in
Your medical bill is 2345 your health insurance covers 70% after a 120 deductible what amount of the bill will you pay
astra-53 [7]
The solution for the problem is:
Since there is $120 deductible, you get to pay…$2345 - $120 = $2225.
But since the insurance covers 70%, so you will only pay the 30%, so it is:30% x 2255 =30/10 * 2225 == $667.50 would be the amount you will be paying.
3 0
3 years ago
Read 2 more answers
If a seed is rr what is the phenotype
cluponka [151]
I think it depends on what it is about.. Did your teacher give you a punnett square or anything like that?
5 0
3 years ago
Match the organism to the infection: Group of answer choices Streptococcus pyogenes [ Choose ] Varicella zoster [ Choose ] Papil
slavikrds [6]

S. pyogenes causes Strep throat, Varicella zoster causes varicella, Papillomavirus causes HPV, E. faecium cause urinary tract infection B. burgdorferi causes Lyme disease and B. pertussis causes Pertussis.

<h3>What is Bordetella pertussis?</h3>

Bordetella pertussis is a  bacteria from the genus Bordetella that causes a respiratory disease known as Pertussis.

Moreover, Bordetella burgdorferi is another bacteria from genus Bordetella that causes Lyme disease, an illness whose symptoms include fever and fatigue.

In conclusion, Streptococcus pyogenes causes Strep throat, Varicella zoster causes varicella, Papillomavirus causes HPV, Enterococcus faecium cause urinary tract infection Borrelia burgdorferi causes Lyme disease and Bordetella pertussis causes Pertussis.

Learn more about Lyme disease here:

brainly.com/question/12185102

#SPJ1

3 0
2 years ago
I NEED HELP WITH SCIENCE!!!
Maslowich

Answer:

  1. corrosion
  2. bases
  3. 7
  4. It warys of how much concentration there is
  5. over 7

EXPLANATION:

plz can i get brainliest:)

5 0
2 years ago
What do we pass onto future generations?<br> A. Bacteria<br><br> B. DNA<br><br> C. Homework
musickatia [10]
DNA I’m not sure if im right sorry if im wrong
4 0
2 years ago
Read 2 more answers
Other questions:
  • Write the dna complementary strand for GGCATTCGCGATCATG
    14·1 answer
  • A baseball catcher throws a ball vertically upward and catches it in the same spot as it returns to the mitt. At what point in t
    9·1 answer
  • In the image below, which region is showing an abnormally low sea level? A B C D
    8·2 answers
  • What part pf the brain regulates stress?
    5·1 answer
  • _____ is the intentional changing of DNA or the human-controlled transfer of DNA from one organism to another.
    6·2 answers
  • Which phrase describes one characteristic of radioactive elements
    7·2 answers
  • Which of the following reasons explains why some cooking pots are made of metal, but their handles are made of wood? A. Both woo
    5·2 answers
  • Explica y escribe en su cuaderno, los tipos de procesos, los cómo llega el oxígeno a los seres vivos, y de donde proviene el oxí
    7·1 answer
  • “The 24 hour day period comes from”
    6·1 answer
  • According to the chart, which substance has the lowest OH- concentration?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!