All categories

2 years ago

What happens in people that have this difference in their DNA?

Biology

1 answer:

muminat2 years ago

3 0

Answer:

Explanation:

DNA comes in long strands called chromosomes, which are kept inside the nucleus of a cell. Every one of our cells has a nucleus with all of the DNA. Each cell is different not because of the bits of DNA in it, but because of the bits it uses to make things.

Each strand of DNA is made up by joining together nucleotides. There are four different nucleotides called adenine (A), thymine (T), cytosine (C) and guanine (G). If you could see the nucleotides in a strand of DNA it would look something like this: AACGTATTGACATAGGGGGGCCTACTTA

It is quite extraordinary that just four different nucleotides make up the code of every single living thing. The order that these nucleotides are in determines the difference between a brain cell, a toenail, a blood cell and whether or not we have a certain disease.

So if you wrote out the DNA sequences of two people and matched them up together, they would look almost exactly the same. There would be about 1 difference in every 100 nucleotides (it’s actually more like 1 in 1000). These differences determine whether you have blonde hair or brown, whether you are tall or short, whether you will have asthma or not.

You are more similar to people you are related to because your DNA came from the same place; your great, great, great grandparents, or something like that. Your DNA is a combination of your Mum and Dad’s DNA, half from each. So you are half the same as your Mum, half the same as your Dad. If you looked at the DNA of a friend you are not related to, they would also be half the same as their Mum, and half the same as their Dad, but they would be quite different to you. This is because the last common ancestor (person who is related to you both) was so many hundreds or thousands of years ago, that a lot of changes have occurred in the DNA sequence since then.

You might be interested in

Resident microflora:

CaHeK987 [17]

Answer:

Resident microflora b. may be responsible for opportunistic infections in immunocompromised

Explanation:

It is almost impossible to found these microorganisms in the stomach because of the acidic conditions, most of them are not adapted to this type of environment. Resident microflora is not transient, is actually permanent. However, resident microflora may be responsible for ooportunistic infections in immunocompromised and they can also increase the intensity of the disease produced by that pathogen.

7 0

2 years ago

1. A _________

Step2247 [10]

Answer:

1.ans Phylogenetic Trees

Scientists use a tool called a phylogenetic tree to show the evolutionary pathways and connections among organisms. A phylogenetic tree is a diagram used to reflect evolutionary relationships among organisms or groups of organisms.

2.ans Binomial Nomenclature Rules

The entire two-part name must be written in italics (or underlined when handwritten). The genus name is always written first. The genus name must be capitalized. The specific epithet is never capitalized

3.ans Dichotomous Key

A dichotomous key is a tool created by scientists to help scientists and laypeople identify objects and organisms. Typically, a dichotomous key for identifying a particular type of object consists of a specific series of questions.

8 0

2 years ago

Which of the following is an example of a group of prokaryotic organisms?

Ket [755]

<span>An example of a group of prokaryotic organisms is C. Archaea. There are three domains of life: Archaea, Bacteria, and Eukarya. Archaea and Bacteria are prokaryotic organisms. On the other hand, domain Eukarya includes all eukaryotic organisms, such as Protists, Fungi, Plants, and Animals.</span>

7 0

3 years ago

Read 2 more answers

Under what conditions does natural selection occur?

Helen [10]

Four conditions are needed for natural selection to occur: reproduction, heredity, variation in fitness or organisms, variation in individual characters among members of the population. If they are met, natural selection automatically results.

3 0

2 years ago

Arrange these components of the mammalian immune system as it first responds to a pathogen in the correct sequence. I. Pathogen

Mrrafil [7]

Answer:

The correct sequence is:III) Antigenic determinants from pathogen bind to antigen receptors on lymphocytes.

IV) Lymphocytes specific to antigenic determinants from pathogen become numerous.

II) Lymphocytes secrete antibodies.

I) Pathogen is destroyed.

V) Only memory cells remain.

Explanation:

Effective resistance against infection is essential for the development and functioning of the mammalian organism, and for it to be effective, multiple defense systems must be available. In order to meet these objectives, the body has developed a complex system of overlapping and interrelated defense mechanisms, which together can destroy or control almost all invaders.III) Antigenic determinants from pathogen bind to antigen receptors on lymphocytes. It consists of the binding of the foreign antigen to the specific receptors existing on the membrane of mature lymphocytes. The B lymphocytes that mediate humoral immunity express antibody molecules on their surface, which bind to foreign proteins, polysaccharides or lipids in their soluble form; T lymphocytes, responsible for cellular immunity, express so-called T cell receptors (TCR), which recognize small sequences of antigenic peptides.

IV) Lymphocytes specific to antigenic determinants from pathogen become numerous.II) Lymphocytes secrete antibodies.

Activation phase: sequence of events that occur in lymphocytes as a result of specific antigen recognition. All lymphocytes undergo two fundamental changes: a) proliferation: expansion of antigen-specific clones and amplification of the protective response, in which the CD4 T lymphocyte, capable of activating CD8 B and T lymphocytes, assumes a preponderant role; b) differentiation: stage in which effector cells and memory cells are formed. The first produce various substances that can interact with the antigen, such as antibodies and lymphokines; the second are partially differentiated lymphocytes, that is, they do not become effector cells.

I) Pathogen is destroyed.

In this phase, the T lymphocytes differentiated into effector cells migrate to the sites of attack, where they carry out their functions of eliminating pathogens, while the B lymphocytes perform them in the peripheral organs themselves.

V) Only memory cells remain.

One of the most important consequences of the adaptive immune response is the establishment of the state of immunological memory, which lies in the ability of the immune system to respond more quickly and efficiently to microorganisms that have previously infected the host and it reflects the preexistence of a clonally expanded population of antigen-specific lymphocytes. We call, therefore, the immune response that the organism gives when it comes into contact for the first time with a foreign agent and from which a series of events derives that include nonspecific innate defense mechanisms and adaptive response mechanisms, if the pathogen manages to survive the first ones.

3 0

2 years ago