1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elza [17]
3 years ago
7

C. _____________________ store food or pigments.

Biology
1 answer:
Tcecarenko [31]3 years ago
6 0

Answer:

Plastids

Explanation:

You might be interested in
1. How many minutes does it take a P wave to travel 2000 Km?
yuradex [85]

Answer:

6.7 minutes

Explanation:

In a solid such as rock, the primary wave can travel at 5 km/sec; it would take 400 seconds, or about 6.7 minutes to travel 2,000 km.

3 0
3 years ago
Contributing factors that lead to Xenophobia
Furkat [3]
Sorry its a very long answer-
1.) Failure to maintain the rule of law
The government's repeated failures to bring levels of violent crime under control contributed to an environment which saw people resort to violence without fear of arrest or successful prosecution.
2.) Border control

3.) Corruption

4.) Employment

5.) Education
This has been government's biggest failure and carries much of the blame for the high unemployment levels. It is arguable whether current state education is in its totality any better than that under apartheid. Only 1% of black matriculants achieve a good HG maths pass.
The education system is a good example where policy failures in one area compounded those in another.
6.) Slowing economic growth
7.) Foreign policy

8.) Service delivery

9.) Race relations
3 0
3 years ago
Besides helping to discover the structure of DNA, describe two other contributions Rosalind Franklin made to the world of scienc
Rainbow [258]

Answer: Rosalind Franklin discovered the density of DNA and, more importantly, established that the molecule existed in a helical conformation. Her work to make clearer X-ray patterns of DNA molecules laid the foundation for James Watson and Francis Crick's suggestion that DNA is a double-helix polymer in 1953.

Explanation:

4 0
3 years ago
Match the organ to the number showing the order of blood flow in the circulatory system.
seraphim [82]

er:

Explanation:

In the lungs CO2 is removed from the blood and send out the body where we exhale

5 0
3 years ago
Una mujer lleva en uno de sus cromosomas X un gen letal recesivo (l), y en el otro alelo dominante normal (L). ¿Cuál es la propo
nlexa [21]

Question in English:

A female carries a recessive lethal gene (l) on one of her X chromosomes, and a normal dominant allele (L) on the other. What is the sex ratio to be expected in this woman's dependency if she marries a normal man?

Answer:

2/3 females

1/3 males

Explanation:

Females have two X chromosomes (XX) and males have an X and a Y chromosome (XY).

The genotype of the female is XLXl. The genotype of the male is XLY, since he is normal.

The possible genotypes are:

<u>                            XL                  Xl</u>

<u>XL</u>                     <em>XLXL             XLXl</em>

<u>Y</u>                       <em>XLY               </em><em>XlY</em>

<em />

All female offspring will be normal as they will always have one normal copy of the X chromosome from their father.

50% of the male offspring will be normal, but 50% will inherit the lethal gene from their mother.

Because the allele is lethal, that means XlY males will not be born.

That means 2/3 of the children will be females, and 1/3 will be males.

8 0
3 years ago
Other questions:
  • Why cant any living organism suvive on the martain surface?
    13·1 answer
  • Before removing a bird from its cage, you should?
    14·2 answers
  • Name the three types of scientific investigations.
    10·2 answers
  • the diagram below is showing the use of a transport protein to move particles across the membrane what type of thransport is thi
    10·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Who was an American that was able to significantly improve the quality of the magnified images with his microscopes?
    12·2 answers
  • (PLEASE HELP MEH, IM 2 STOOPID)
    12·1 answer
  • Describe the processes by which root hair cells absorb water and mineral ions from the soil
    12·1 answer
  • Meeting URL: /ucx/fnfp/nay to clear doubts ​
    12·1 answer
  • Obviously charged objects attract each other this attraction holds electrons and atoms and holds atoms to one another in many co
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!