RFLP or Restriction Fragment Length Polymorphism exploits the variation of homologous DNA (Deoxyribonucleic Acid) sequences. This technique is frequently used in different types of analysis such as genotyping, paternity tests, forensics, hereditary disease diagnostics, and many others. In diagnosing diseases, PCR is use to find the DNA of pathogens in small amounts to diagnose hundreds of genetic diseases. While in forensic investigations, PCR can give a probably ID from 20 cells.
It should be
AGATACCATGGTTACCCGGTTCCA
By performing this dance, successful foragers can share, with other members of the colony<span>, information about the direction and distance to patches of flowers yielding nectar and pollen, to water sources, or to new nest-site locations.</span>
Plant and animal cells both undergo mitotic cell divisions. Their main difference is how they form the daughter cells during cytokinesis. During that stage, animal cells form furrow or cleavage that gives way to formation of daughter cells. Due to the existence of the rigid cell wall, plant cells don't form furrows.
