1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Contact [7]
3 years ago
9

I’m trying to find a answer online it’s just not working. This is for my personal interest:

Biology
1 answer:
adell [148]3 years ago
5 0

I’m trying to find a answer online it’s just not working. This is for my personal interest:

Do growth plates grow and close at the same time? For instance, the ones in your feet, do the growth plates in both feet stop moving at the exact same time?

You might be interested in
Why is wood used on the handles of some tools?
alisha [4.7K]
Is this a serious question ? loool
3 0
4 years ago
What process of cellular respiration occurs at the inner membrane of the mitochondrion? (2 points) Fermentation Glycolysis Krebs
vlada-n [284]
Electron transport chain (ETC)
4 0
4 years ago
Read 2 more answers
Why do most proteins need near a neutral pH?
gregori [183]
I'm not sure I'm sure some one will text u
6 0
4 years ago
The two forms of energy that have the least impact on the environment are: __________ and _________.
Natali [406]

The two forms of energy that have the least impact on the environment are Wind and Solar energy. Both of this energies are clean and renewable. Not only that but they produce no emissions and result in cleaner air and water for all.


<span>Answer: Wind, Solar</span>

<span>
</span>

<span>I hope it helps, Regards.</span>

5 0
4 years ago
Scientists observe or measure a second condition that results from an experiment is called
miskamm [114]

Explanation:

sounds hkoihv bbkoiy iu

6 0
3 years ago
Other questions:
  • Which one of the following reactions occurs in the cristae of the mitochondria? A. The citric acid cycle B. The electron transpo
    15·1 answer
  • Based on your understanding of radioactive isotopes and Alzheimer's disease, what might occur with the use of radioactive isotop
    9·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • How did the battle between the mycenaeans and the troy begin and end?​
    5·1 answer
  • WILL GIVE BRAINLIEST!!!!!!!
    12·1 answer
  • A gene can have many alleles. Why is it that any given person only carries two copies of each allele
    13·1 answer
  • The diagram shows an example of a food web. What are common traits of the prey shown that help them survive? What might happen i
    11·1 answer
  • Look at the diagram. What is the name of muscle 1?<br> Enter your answer<br> 2<br> 4
    5·1 answer
  • What type of energy is necessary for photosynthesis to occur?
    11·2 answers
  • What information can a scientist learn directly from a single fossil?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!