1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ASHA 777 [7]
3 years ago
7

Lifestyle choices Definition

Biology
1 answer:
seropon [69]3 years ago
3 0

Answer:  Lifestyle choices are personal decisions to perform a behavior.

You might be interested in
The North Atlantic right whale migrates between subtropical and polar waters annually. Nearly 50 percent of right whale deaths a
Mekhanik [1.2K]
Sonar testing has caused whales to die in mass amounts.
8 0
1 year ago
List at least five organisms that are present un your biological community
grigory [225]

Answer:

a forest of trees and undergrowth plants, inhabited by animals and rooted in soil containing bacteria and fungi, constitutes a biological community.

Explanation:

8 0
3 years ago
Read 2 more answers
Describe the potential effects when a keystone species is removed from a community.
Vlad [161]

Answer:

Explanation:

A keystone species is the one which plays an important role in maintaining the structure of the ecosystem. On the keystone species many other species of the ecosystem are dependent upon.  

The potential effects associated with the keystone species includes the following:

1. No other species will be capable of filling the same ecological niche. Hence, the dependent organisms will suffer and the ecosystem will change drastically.

2. The ecosystem will be populated by the invasive species which will affects the population of native species.

5 0
3 years ago
How do bacteria regulate transcription of these operons?
Semmy [17]
Kindly see answers below:

1. operon is not transcribe• b.) lac operon: lactose absent• e.) trp operon: tryptophan present2. operon is transcribed, but not sped up by the positive control• a.) trp operon: tryphophan absent• d.) lac operon: lactose present, glucose present3. operon is transcribed quicklu through positive control• c.) lac operon: lactose present, glocuse absent
7 0
3 years ago
The client is scheduled to get a breakfast tray at 07:00. at what time should the client receive a prescribed dose of insulin li
Vera_Pavlovna [14]

<span>Insulin lispro is a mealtime insulin which is rapid-acting. Insulins are taken  15 minutes before or 15 minutes after.  If a client is </span><span>scheduled to get a breakfast tray at 07:00, the client must receive a prescribed dose of insulin lispro at 6:45 or 7:15. </span>

8 0
3 years ago
Other questions:
  • Which of the following statements are true regarding the process of photosynthesis
    8·1 answer
  • Why doesn’t photosynthesis occur in deep ocean water
    11·2 answers
  • Vitamins and minerals keep the blood healthy. Which part of the blood carries minerals, vitamins, and other nutrients to the bod
    7·1 answer
  • Instead of having roots and leaves, molds grow as thread-like filaments called _____.
    5·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which best describes autolysis
    10·1 answer
  • The kidneys are organs that are involved in which process in mammals?
    13·2 answers
  • For what reasons could a theory be changed or replaced? Check all that apply.
    10·1 answer
  • What part of the DNA is responsible for the inheritance of trait
    12·1 answer
  • When DNA condenses in preparation for cell division, it is called a __________.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!