1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Soloha48 [4]
3 years ago
15

PLEASE HELP MEEEE! NOT FOR BEGINNER!

Biology
1 answer:
Paladinen [302]3 years ago
4 0

Answer:

B the water receded

Explanation:

You might be interested in
100 POINTS!!!!!! Help FAST!!!!!!!!!!!!!!The picture below shows the bone structures of human, cow, and horse.
11111nata11111 [884]

Answer:

option A they have developed from the same organism

Explanation:

Organs of animals (belonging to different species) which have similar structure but different functions are homologous organs. Such organs have evolved from the same ancestors , however their function are different.  

For example – wings of bats, limb of human etc.  

Here in this case  also the bone structures of human, cow, and horse are same but their functions are different, thus they are homologous organs and hence they have evolved from same ancestors.  

The correct answer is option A

7 0
3 years ago
How does acid rain involve/affect the water and carbon cycle?
nevsk [136]
They acid effect it by making water undrinkable, and it can corrode steel and etc. Hope this helps
7 0
3 years ago
PLEASE HELP Fermentation is also called
Ludmilka [50]

Fermentation occurs without oxygen, so it is anaerobic respiration (without oxygen respiration)

3 0
3 years ago
Read 2 more answers
Which are uses for DNA fingerprinting? Choose ALL correct answers.
Burka [1]

Answer:

The first and last box. If you don't agree with the first then definitely consider the last box.

3 0
3 years ago
Read 2 more answers
What the heck do these terms mean I forgot my txbk but I have the rubric help me now plzzzzzz 50- 98 pts!!!
mel-nik [20]
Nebula- a cloud of gas and dust in outer space
Protostar- a contracting mass of gas which represents the early stage of formation in a star
White Dwarf- a stellar remnant composed mostly of electron-degenerate matter
Supernova- transient astromnical event that occurs during th last stellar evolutionary stages of a massive star's life
Neutron Stars- a type of compact star
Pulsar- a highly magnetized rotating neutron star
Black Hole- a region of space-time exhibiting so much gravitational effects that nothing can escape from inside it
Spiral Galaxy- flat, rotating disc containing stars, gas, and dust
Barred-spiral Galaxy- central bar-shaped structure composed of stars
Irregular Galaxy- a galaxy with no distinct, or regular shape
Quasar- a massive and extremely remote celestial object, emitting large amounts of energy      
The Big Bang Theory- a cosmological model that explains the early development of the universe 
Dark Matter- a hypothetical substance that is believed by most astronomers 
Dark Energy- unknown form of energy which is hypothesized to permate all of space
7 0
4 years ago
Read 2 more answers
Other questions:
  • What two enzymes are needed to produce a dna molecule?
    7·1 answer
  • When a scientific investigation produces evidence that does not support the hypothesis, what can you conclude about the investig
    5·2 answers
  • The part of the brain responsible for maintaining coordination, balance, and smooth motions is the:
    9·1 answer
  • A student uses paper towels to clean up a small chemical spill in the lab. Where should the dirty paper towels be placed ? A. In
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A population of beetles lived in a particular ecosystem. Beetles in this population varied in size from small to large and range
    10·1 answer
  • Which of these choices allows people to pass down survival techniques from
    7·2 answers
  • Embryonic stem cells are pluripotent because they can
    15·1 answer
  • What's the relationship between photosynthesis, chlorophyll, thylakoids, and chloroplasts?
    8·1 answer
  • Describe two kernel data structures in which race conditions are possi- ble. be sure to include a description of how a race cond
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!