1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gnesinka [82]
3 years ago
5

Please help its for a test!!

Mathematics
1 answer:
adoni [48]3 years ago
7 0

Answer:

Probably shouldn't cheat on tests

Step-by-step explanation:

just sayinnn

:/

Pretty sure option 4 is your answer though. Not 100% because the picture is a bit blurry

You might be interested in
Expand the following by using the distributive property: 6(-3w+1/3)
zepelin [54]

Answer:

-18w+2

Step-by-step explanation:

6*-3w=-18w

1/3*6=2

7 0
3 years ago
Read 2 more answers
Tell which measure is greater. One yard or one meter?
tensa zangetsu [6.8K]

Answer:

one yard one yard is bigger. 1 yard=0.9144 meter

8 0
3 years ago
Read 2 more answers
Multiplying Binomials
ch4aika [34]

Answer:

Concept: Binomial Multiplication

  1. (x-1)(x-9)
  2. x^2-9x-x+9
  3. x^2-10x+9

5 0
3 years ago
5) 18 x1
elena55 [62]

Answer:

C

Step-by-step explanation:

hope this helps!!! have a nice day

7 0
3 years ago
Fran has a monthly income of $2940, and budgets 9% of that amount for groceries.
notsponge [240]

Answer: $265

Step-by-step explanation: Fran has a monthly income of $2940, and she budgets 9% of it for groceries. 9% of $2940 is $265 dollars.

Hope this helps!

7 0
2 years ago
Other questions:
  • Determine if the statement is always ,sometimes, or never true.
    14·1 answer
  • Find the measure of HIW in picture.
    10·1 answer
  • Find two integers whose sum is 0 and product is -16
    13·1 answer
  • Farah found 7 rolls of teal ribbon and blue ribbon. Each roll of teal ribbon was 1 meter long and each roll of blue ribbon was 7
    14·1 answer
  • Question of The Day: Solve this equation. Can 1/5 be divided?
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Is 5/12 greater than 0.44
    8·2 answers
  • Is this a function and what's the domain and range. thanks!
    12·2 answers
  • 2L plus 2L plus 1.5L plus 2.5L=8L just making shore it is right?
    15·2 answers
  • Geometry Help!
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!