The scarlet ibis (Eudocimus ruber) is a species of ibis in the bird family Threskiornithidae. ... Traditional Linnaean taxonomy classifies it as a unique species, but some scientists have moved to reclassify it as a ... More recent observation, however, has documented significant crossbreeding and hybridization in the wild.
Answer:
The answer is natural selection
Explanation:
The modern theory of evolution was developed by Charles Darwin, an amateur English naturalist, in the 19th century
D-low elevation and low relief
Answer:
Option C.
Ocean acidification is the main ecological problem due to mariculture.
Explanation:
- Mariculture also known as the aquaculture that stands for the fish farming occupation.
- The main ecological problem that mariclture addresses is the environmental degradation especially the water pollution.
- Many studies suggests that the tradition of mariculture has been increasing the acidificaton in ocean water that is directly affecting the marine organisms and plants.
- A build up of organic material beneath fish farms impacts the flora and fauna of an area.
- That makes drastic changes on sediment chemistry.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
