1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lutik1710 [3]
2 years ago
12

What are the examples of recombinant vaccines?

Biology
1 answer:
N76 [4]2 years ago
7 0

Answer:

The classical example of recombinant protein vaccines currently in use in humans is the vaccine against hepatitis B (Table 1) (10). Hepatitis B virus (HBV) infection is a chronic liver disease occurring worldwide.

Explanation:

You might be interested in
Since prokaryotic cells _______________________, they have the ability to adapt faster to changing environmental conditions than
I am Lyosha [343]

Since prokaryotic cells are haploid, they have the ability to adapt faster to changing environmental conditions than eukaryotic cells.

<h3>What are prokaryotic cells?</h3>

Prokaryotic cells are cells that are characterized by the absence of a nucleus or any other membrane-bound organelles.

On the other hand, eukaryotic cells have the presence of a membrane-bound nucleus that stores their genetic material.

Another important feature of prokaryotic cells is that they are haploid in nature i.e. they do not have chromosomes that occur in homologous pairs and have just one chromosome.

Therefore, it can be said that because prokaryotic cells are haploid, they have the ability to adapt faster to changing environmental conditions than eukaryotic cells.

Learn more about prokaryotic cells at: brainly.com/question/18348786

#SPJ1

7 0
1 year ago
Which of the following reduces water pollution?
posledela

Answer:

"Creating more paved surfaces"

Option C will be the answer

3 0
3 years ago
The study of psychoneuroimmunology suggests that when a stressful situation is encountered, several biological reactions occur,
zhenek [66]

Answer: d) lightheadedness or unconscious episodes.

Explanation:

There are several ways the body responds to stress but one method used by psychologists to measure this response is Hans Selye's general adaptation syndrome. This occurs in 3 stages:

1. The alarm reaction. This occurs when the stressor is first presented resulting in the RELEASE OF HORMONES from the adrenal gland into the blood stream. The hormone in turn cause sympathetic nervous system activation and increase energy levels, INCREASE RESPIRATION, increase muscle tension, reduce sensitivity to pain, slow down the digestive system, and cause a RISE IN BLOOD PRESSURE.

2. The stage of resistance- this occurs till the stress is removed.

3. The stage of exhaustion

7 0
2 years ago
Read 2 more answers
In colorectal cancer, some tumor suppressor genes are inactive. This is an important factor resulting in uncontrolled cell divis
tresset_1 [31]

Answer/Explanation:

(1) a mutation in the coding region, resulting in an inactive protein

To check to see if there is a mutation, you could extract the DNA from the cancer cells and then perform PCR to amplify the gene of interest. You could then perform sanger sequencing and compare the sequence to the normal gene to see if a mutation is present. To test the effect of the mutation, you would want to see if an active protein has been formed.

To see if a normal sized protein has been formed, you could perform a western blot, comparing the protein band to the WT protein band. If the protein is absent or much smaller, it is likely not a functional protein.

(2) epigenetic silencing at the promoter of the gene, resulting in reduced transcription.

To check for changes in the epigenetic landscape of the promoter, you could perform chromatin immunoprecipitation by extracting the chromatin from the tumour cells and using antibodies for different chromatin marks to see what has changed between the normal cells and the tumor cells. E.g. H3K9me3, H3K27me3. You would perform a pull down with the antibody of interest and then PCR for your promoter to specifically look at changes at that gene compared to normal cells. To test DNA methylation, you could perform bisulfite sequencing.

To see how transcription is affected, you could extract RNA from the tumor and normal cells, and compare the levels of RNA between the two samples by qRT-PCR

3 0
3 years ago
What are the importance in applying fertilizer to a tree?​
MatroZZZ [7]

Answer:

It helps in growth of fruits or root faster .

Explanation:

If fertilizers is applied on trees , insect won't affect and soil will be fertilized for appropriate growth .

3 0
3 years ago
Other questions:
  • 12. Which molecules must be present in order for energy production to
    9·1 answer
  • What is another animal that exhibits an incredible phenomenon and how can it be used to make life better for humankind
    10·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • In 2003 what was archived by the human genome project
    5·1 answer
  • What are the main functions of DNA polymerase?<br> Please help asap
    9·1 answer
  • Which of the following includes the development of plaque and tangles in the brain? (2 points)
    7·2 answers
  • Hi guys can you guys help me with this question plsss​
    7·2 answers
  • 1.You have an unknown piece of matter in front of you that you believe to be a piece of bark from a tree. First, how would you d
    7·1 answer
  • What is your definition of the word biochemistry?
    15·1 answer
  • Which of the following regarding puberty is FALSE? Select one: a. Early signs of puberty include breast budding in girls and gro
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!