1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
2 years ago
8

Kinetic energy is a function of

Biology
1 answer:
777dan777 [17]2 years ago
5 0
A. the kelvin temperature scale
You might be interested in
All of the following events occur during normal meiosis except _______. A. two haploid gametes fuse to form a diploid cell B. on
lesya692 [45]

Answer:

A. two haploid gametes fuse to form a diploid cell

Explanation:

Meiosis is a type of cell division. When a parent cell with "2n" chromosomes enters the process of meiosis, four daughter cells each with "n" chromosomes are formed. This occurs since homologous chromosomes separate from each other during anaphase-I. However, meiosis does not include the fusion of two haploid cells. The fusion of two haploid cells mainly occurs during the process of fertilization during which a haploid male gamete and a haploid female gamete fuse to form a diploid zygote.

7 0
3 years ago
A nation has a population growth rate of 3.2%. The country currently has a population of 12 million. In how many years will the
Tamiku [17]

Answer: A) 44 years

Explanation:

6 0
2 years ago
The basic unit of all forms of life is a(n)
finlep [7]
The basic unit of life is a D. cell. 
D is the correct answer because although life is also made up of the other options, in the end, they are all made up of cells. A tissue is a group of specialized cells, and an organ is made up of different tissues. An organ system is a system of organs that work together.
Hope that helped you.
7 0
3 years ago
Read 2 more answers
Which of these statements about trophoblast is false?
lukranit [14]

Answer:

The statement C that says ''is derived from the inner cell mass'' is false.

Explanation:

The trophoblast is a structure composed of a set of cells (cytotrophoblast and syncytiotrophoblast), which are shaping the outer layer surrounding a blastocyst, during the earliest stages of embryonic development that mammals pass.

The trophoblast provides nutritive molecules to the developing embryo and facilitates its implantation to the uterine wall due to its ability to erode the tissues of the uterus, that is, it is responsible for making it possible for the embryo to be implanted in the uterine endometrium. Thus, the blast can join the cavity formed by the uterine wall, where it will absorb nutrients from the fluid from the mother.

During the third week, embryonic development includes the development of the trophoblast. At the beginning, the primary villi are formed by the internal cytotrophoblast which is surrounded by the outer layer of syncytiotrophoblast. Then, the cells found in the embryonic mesoderm are directed to the primary villous in the third week of gestation and when it ends, the mesodermal cells begin to be singled out to form blood vessel cells.

7 0
2 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Like animals, plants undergo cellular respiration to produce energy. Plants use oxygen and release carbon dioxide and water. Wat
    6·2 answers
  • How many cell divisions would it take to produce at least 1,000 cells from one cell
    6·1 answer
  • A cell is 20 micrometers across. What type of cell is this? A. Plantae B. Eukaryotic C. Animalia D. Prokaryotic
    11·2 answers
  • Help Please !!
    15·1 answer
  • If a cell contains a set of duplicated chromosomes, does it contain any more genetic information than the cell before the chromo
    10·1 answer
  • Which one of the following is true for a theory?
    14·1 answer
  • What, if anything, is missing from the article that would help you evaluate whether the conclusion is justified
    7·2 answers
  • Somatic cells divide by ___________________ to provide two identical daughter cells that look like the original cell while sex c
    7·2 answers
  • The length of a DNA double helix increases by 0.34 nm (nanometres) for every pair of nucleotides. The total number of nucleotide
    5·1 answer
  • When dna microarrays containing asos are used to genotype snps, what form of dna constitutes the probe molecules?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!