The milky way is your answer
Yes, human activities are a significant cause of the increase in the amount of Carbon dioxide in the atmosphere.
<h3><u>
Explanation:</u></h3>
The increasing amount of 
is a big problem in today's world for the atmosphere. Human activities are playing a vital role in the rise in . Carbon emission is majorly happening because of pollution. The pollution by vehicle, wax factories, chemical factories, etc. also, some other kinds of Carbon emission activities are there like burning coal and plastic produces Carbon in very high amount and this Carbon directly mix into the atmosphere.
Due to the increase in , both natural and agricultural ecosystems are suffering. causes air pollution, and because of that, the quality of crops is declining day by day. Also, the natural vegetation is struggling as the rainwater is also not pure; the amount of acidic content in natural rain is increasing per year. All these activities are leading towards global warming, which one day will bring our earth to an end. So it is imperative to take some severe legal measures to save the environment and decline the amount of producing.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
I have a chart for this if you'd like that it really helps to better understand the Nitrogen Cycle and how it works.
Answer:
The correct answer is - acidic conditions wouldn't trigger a change in the color of Alizarin yellow.
Explanation:
The growth of E. coli generally occurs at neutral pH, however, its growth is normal at acidic conditions as well. The change in the growth of E. coli is not able to detect by alizarin.
The phenol red turns yellow in the presence of an acid, and the change in pH in an alkaline environment can be detected by the red color of phenol red. Growth of E.coli will grow in pH of 10-12 . But, very slowly. The color change in alizarin is also apparent at pH 10.2 to 12 only.
