1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
3 years ago
12

Briefly (3-5 sentences) summarize cell division in prokaryotic cells.

Biology
1 answer:
swat323 years ago
8 0

Answer:

Prokaryotic cells have a ring-shaped nucleus, however it is not fully defined, and thanks to this, their DNA is found unlike eukaryotic cells, scattered in the cytoplasm, an example of a prokaryotic cell is a bacterium, which has Oval shaped

uwu

Hope I help!

You might be interested in
You are feeling really yucky . You are very warm and are beginning to sweat . you take your temperature and it says that it is 1
Alexandra [31]

Answer: You are sick and you might have the flue of a fever.

Explanation: cause if your sweating bad and you take your temature and its hight then your sick.

3 0
3 years ago
What is meant by heridity? ​
densk [106]

Answer:

Heredity, also called inheritance or biological inheritance, is the passing on of traits from parents to their offspring; either through asexual reproduction or sexual reproduction, the offspring cells or organisms acquire the genetic information of their parents

3 0
3 years ago
Suppose a doctor had a young patient that was not growing as quickly as he should. The patient's bones seemed to be soft and wer
andrew-mc [135]
The answer 4 the above question sounds like a vitamin D deficiency.
4 0
3 years ago
What will charles darwin have to say about lamarcks theory?
iragen [17]
He would say that Lamarck's theory is wrong. Lamarck's theory stated that traits that are used are passed on to the offspring. In other words, if an organism changes during its lifetime in order to adapt to its environment, then its changes will be passed on to its offspring. This is wrong because this means that organisms pass on traits based on genetic information and not based on the environment of the offspring.

Hope this helps.
8 0
3 years ago
An important feature of modern classification systems is that they
padilas [110]
Show differences between species/organisms
5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Jim releases a compressed spring. Describe the energy transformation taking place in the spring.
    6·1 answer
  • What can go wrong with a cell wall?
    10·2 answers
  • During a ________ moon, we see one whole side of the Moon here on Earth.
    5·2 answers
  • ¿Cuál es el animal más peligroso del mundo y por qué?
    12·2 answers
  • 5 sentence on importance of including vegetables in diet
    9·1 answer
  • 100 POINTS..!!
    12·2 answers
  • Look at the graph to the right. What does it show?
    7·1 answer
  • Fill out the Alien Periodic table
    9·1 answer
  • 3.<br> List, in order, the six steps of the growth cycle for all living things.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!