1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AnnyKZ [126]
2 years ago
6

Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an a

nimal’s pattern of movement in order to avoid injury. A handler must know where to stand in order to avoid injury. A handler must know proper feeding procedures in order to avoid injury. A handler must not use a loud voice in order to avoid injury.
Biology
1 answer:
fomenos2 years ago
8 0

Answer:

A handler must know an animal’s pattern of movement in order to avoid injury.

Explanation:

Point of balance refers to equalibrium so if you know the animals pattern of movemenrt you are less likely to get injured while moving on or with it.

You might be interested in
A controlled experiment___. A. Includes one group for which the scientist controls all variables. B. Includes at least two group
notsponge [240]

Answer:

The correct answer is:

Includes at least two groups, one of which does not receive the experimental treatment. (B)

Explanation:

A controlled experiment is made up of at least two groups of participants (subjects). One group (the test group) receives the experimental treatment, which can be an intervention or a new drug to be tested etc, and the effect of the treatment on the subjects is measured, while the second group of similar subjects also known as the control group acts as a baseline and do not receive the treatment or intervention. They act as a baseline to ensure that the change observed in the treatment group was brought about as a result of the treatment.

<em>Note that repeating the experiment several times does not ensure accuracy of the result, rather it ensures reliability of the results hence option D is not correct</em>

5 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Which of the following BEST describes the hydrosphere
kotegsom [21]
The answer is basically D
3 0
3 years ago
Read 2 more answers
The rhythmic contractions of the stomach and intestine that propel food along are called
Usimov [2.4K]
The rhythmic contractions of the stomach and food along the alimentary canal is called peristalsis
4 0
3 years ago
Which example describes an inherited trait that cannot be determined by observing an individual?
kvv77 [185]
Blood type because looking at someone, you cannot determine their blood type.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Why would a farmer plant a food crop in am small garden plot?
    5·1 answer
  • Number 7 <br> Its about cells
    14·1 answer
  • What are 2 ways the environment recycles energy and nutrients and how do they work?
    6·2 answers
  • Can't figure it out need help asap
    5·2 answers
  • (1) What transports oxygen through the body?
    7·1 answer
  • Which plant has a visible leaf modification that will help it conserve water in extremely dry environments?
    9·2 answers
  • Autism is a disability that results from a disorder in the central nervous system. it has been speculated that the increasing nu
    10·2 answers
  • What characteristic defines this organism as eukaryotic
    5·1 answer
  • Which tissue is made of more than one type of cells?
    7·2 answers
  • Which phase of mitosis is shown in the diagram?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!