Answer:
The correct answer is:
Includes at least two groups, one of which does not receive the experimental treatment. (B)
Explanation:
A controlled experiment is made up of at least two groups of participants (subjects). One group (the test group) receives the experimental treatment, which can be an intervention or a new drug to be tested etc, and the effect of the treatment on the subjects is measured, while the second group of similar subjects also known as the control group acts as a baseline and do not receive the treatment or intervention. They act as a baseline to ensure that the change observed in the treatment group was brought about as a result of the treatment.
<em>Note that repeating the experiment several times does not ensure accuracy of the result, rather it ensures reliability of the results hence option D is not correct</em>
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
The answer is basically D
The rhythmic contractions of the stomach and food along the alimentary canal is called peristalsis
Blood type because looking at someone, you cannot determine their blood type.