1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
6

What causes the different sessions on earth

Biology
1 answer:
const2013 [10]3 years ago
5 0
Earth has seasons because our planet's axis of rotation is tilted at an angle of 23.5 degrees relative to our orbital plane the plane of Earth's orbit around the sun. The tilt in the axis of the Earth is called its obliquity.
You might be interested in
During El Niño, warm water moves from Australia to the coast of South America. Which change does this cause to Australia?
Brrunno [24]

Answer: burning organic matter

Explanation:

8 0
4 years ago
Select the correct answer. George has several plants in his garden. Once in a while, he adds fertilizer to the soil. The leaves
schepotkina [342]

Answer:

Vesicle

Explanation:

Vesicles are organelles which are found in cells and are involved during the process of exocytosis, endocytosis or movement of materials within the cell.

In the question , The leaves absorb the nutrients in the fertilizer and look healthy. If a cell is compared to a plant, the organelle which would help transport fertilizer from the soil to the leaf would most likely be the vesicles.

6 0
3 years ago
A neutral pH level is _____.<br><br> A) 5<br> B) 7<br> C) 8
zmey [24]
PH7.....................
4 0
4 years ago
Which container uses up the most resources from the environment if used just once?
Troyanec [42]
I think it'd be B.. I might be wrong tho..
5 0
3 years ago
Read 2 more answers
Why was charles darwin considered to be revolutionary?
jasenka [17]

Answer:

because the theory of evolution provided a competley naturalistic explanation of life without spiritual basis.

Explanation:

6 0
4 years ago
Other questions:
  • ___________ are lipids that store energy and are typically composed of multiple building blocks containing three fatty acids att
    6·1 answer
  • Which of the following is the school of thought that studies the function and purpose of consciousness and behavior?
    8·2 answers
  • The brain waves of sleeping infants appear to be qualitatively different from those of an adult who is dreaming.
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How does hibernation help bears survive? I need this for a science grade.
    10·2 answers
  • At the end of the practical class, all tissue and the remaining carcass of the cane toad must be placed __________.
    5·1 answer
  • Where is Earth currently warming the most?
    14·2 answers
  • Complete the statement about genetic variation.
    15·1 answer
  • All the different organisms that interact in a pond make up
    11·1 answer
  • What do the Neuron and Epithelial Cells have in common?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!