1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lorasvet [3.4K]
3 years ago
9

What are animals ribs made from

Biology
2 answers:
nikklg [1K]3 years ago
4 0
I believe they are made of the same thing our ribs are made of Bones
natta225 [31]3 years ago
4 0
Bones are calcium build up
You might be interested in
How do gymnosperms adaption make them well suited for land
Anestetic [448]

Answer:

Compared to ferns, gymnosperms have three additional adaptations that make survival in diverse land habitats possible. These adaptations include an even smaller gametophyte, pollen, and the seed. Gymnosperms are plants that bear seeds that are "naked," meaning not enclosed in an ovary.

Explanation:

5 0
3 years ago
What would most likely happen to a person who is not getting enough essential amino acids in his or her diet?
zvonat [6]
It can result in decreased immunity, digestive problems, fertility problems, lower mental alertness, slowed growth. Amino acids play many different roles in the body and the symptoms vary.
7 0
3 years ago
After crossing purebred red (dominant) and purebred white (recessive) flowers, pink flowers appeared. Using symbols, show the cr
-Dominant- [34]
Since after crossing a red and a white flower produced pink flowers, the red color trait shows an incomplete dominance and has a genotype of Rr.
Using the Punnett to determine the cross between pink and white flowers:
   |   R   |   r   |
r  |  Rr  |   rr   |
r  |  Rr  |   rr   |

The results indicate that the cross between pink and white flowers will produce a ratio of 1:1

Rr x rr
3 0
3 years ago
Read 2 more answers
Which organelles contain enzymes that break down old cell parts?
Lena [83]

Explanation:

A lysosome is a membrane-bound cell organelle that contains digestive enzymes. Lysosomes are involved with various cell processes. They break down excess or worn-out cell parts.

6 0
2 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • ________________ is the manipulation of organisms or their components to make useful products.
    5·1 answer
  • What is the location of the parotid lymph node?
    15·1 answer
  • Which trend in hominid evolution can be supported by fossil evidence?
    15·1 answer
  • Your county is considering the purchase of land to form a nature preserve. This land is known as a breeding habitat for an endan
    14·1 answer
  • What amino acid residue would MOST likely be buried in the interior of a water-soluble globular protein?
    11·1 answer
  • What was the "oxygen revolution," which took place 2.3 billion years ago?
    7·1 answer
  • Scientists have conducted multiple experiments on cancer cells to determine how they reproduce. All
    10·2 answers
  • Describe the structures of proteins and nucleic acids, and then explain the relationship between these two molecules within a ce
    9·1 answer
  • Which of the following is a normal process of photosynthesis that could not occur if all reaction centers were inactivated by a
    15·1 answer
  • Explain how the skin on the human body functions similarly to the cell membrane of a cell.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!