1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pickupchik [31]
3 years ago
9

List three pieces of evidence for Pangaea.

Biology
2 answers:
kari74 [83]3 years ago
8 0

Answer:The rock formations of eastern North America, Western Europe, and northwestern Africa were later found to have a common origin, and they overlapped in time with the presence of Gondwanaland. Together, these discoveries supported the existence of Pangea.When Rodinia broke up, it split into three pieces: the supercontinent of Proto-Laurasia, the supercontinent of Proto-Gondwana, and the smaller Congo craton. Proto-Laurasia and Proto-Gondwana were separated by the Proto-Tethys Ocean.

Don't take my full word on it, this is what i think

Explanation:

padilas [110]3 years ago
3 0

Answer:

When Rodinia broke up, it split into three pieces: the supercontinent of Proto-Laurasia, the supercontinent of Proto-Gondwana, and the smaller Congo craton. Proto-Laurasia and Proto-Gondwana were separated by the Proto-Tethys Ocean.

You might be interested in
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
How do meteorologists use isotherms and isobars?
nignag [31]

Answer:

A. To identity high- and low-pressure systems

Explanation:

Isobars are similar to the level lines on a topographic map, showing areas of similar pressure, they are also drawn in circles to represent the areas of similar air pressure over a geographical map.

Isotherms are usually displayed in color showing areas over a map that have the same temperature or are covered by a similar temperature system (heat or cold front for example).

Both are used in electronic media mostly (although in print in newspapers too), over a geographic map to position the systems.

5 0
3 years ago
What is the role of DNA polymerase enzymes in replication?
IrinaK [193]

Answer:

A

Explanation:

the function of DNA polymerase is to unzip the double helix structure of DNA by breaking down the weak hydrogen bond

4 0
3 years ago
Read 2 more answers
If the global warming trend continues and permafrost under the tundra melts, what biome would you predict would replace it?
Vladimir [108]

Answer: If the global warming trend continues and permafrost under the tundra melts, the biome that would you predict would replace it is:

Boreal Forest

Explanation: A boreal forest is a vegetation composed primarily of cone-bearing needle-leaved or scale-leaved evergreen trees, found in northern circumpolar forested regions characterized by long winters and moderate to high annual precipitation.

4 0
2 years ago
Read 2 more answers
What are matching chromosomes called?
Blababa [14]

Answer:

homologous chromosomes

Explanation:

Homologous chromosomes are the same length and have specific nucleotide segments called genes in exactly the same location, or locus.

4 0
3 years ago
Other questions:
  • Object that stores bile in the body is known as what
    14·2 answers
  • I need the answer to 1,3,4,5, and 6
    14·1 answer
  • Differentiated plant cells and tissues include _____.
    12·2 answers
  • If the frequency of the recessive allele for a gene is 0.5, calculate the expected frequency of heterozygotes in the next genera
    5·1 answer
  • What is the function of the organs of the digestive system
    6·1 answer
  • Why phage is consider as a nanomachine? ​
    7·1 answer
  • How do scientific most often gain new knowledge?
    13·2 answers
  • During a knee flexion exercise, when you begin to fatigue what movement will you attempt to perform? Why?
    7·1 answer
  • 1) Can u say why your parents insist that you should eat Regularly ? ​
    8·2 answers
  • What is the largest species of sea turtle in the world?.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!