1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
10

What is the name of the enzyme that breaks down: a. Protein? b. Carbohydrate? c. Fat/oil?

Biology
1 answer:
jekas [21]3 years ago
6 0
A.Protein is the name of the enzyme that breaks down
You might be interested in
A scientist is studying the action of RNA polymerase during transcription. He wants to know what type of bases are added to the
Vinvika [58]
The answer is A. RNA polymerase will be making an mRNA using a single DNA strand as a template. So, for example if the DNA strand is AGGCAGC the mRNA strand will be UCCGUCG. U= uracil which replaces thymine in mRNA molecules. <span>
i hope my answer helped!!!!!!!</span>
4 0
3 years ago
A membrane that only "lets" certain molecules in while keeping other molecules out is ___ ___.
Zanzabum
It is selectively permeable
8 0
3 years ago
Read 2 more answers
When would you expect to find the highest rate of air pressure during breathing?
GalinKa [24]
When your out of breath or when your heart rate is really high.
7 0
3 years ago
The graph represents a _______________ relationship between moose and wolves.
True [87]
Functional is the answer
8 0
3 years ago
Base your answer(s) to the following question(s) on the diagram below and on
Kryger [21]

Answer:

The correct option is <em>Both Cell A&D.</em>

Explanation:

The diagram in the picture shows how a cell (A) undergoes the process of replication and produces a cell (B) containing one full set of double chromosomes.

Then, the cell undergoes the process of mitosis to produce two daughter cells (C & D).

Mitosis can be described as a method of asexual reproduction in which the daughter cells produced are identical to the parent cells and are also identical to each other. Hence, the genetic content of the cell C will be the same as the genetic content of cells A & D.

5 0
3 years ago
Other questions:
  • Hybrid zones provide an opportunity to investigate _____. see concept 24.3 (page 514) view available hint(s) hybrid zones provid
    15·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which three types of pathogens cause disease by trying to get nutrients from your body?
    10·1 answer
  • Just like other magnets, the Earth has
    13·1 answer
  • One characteristic of living things is their ability to change and adapt over time true or false​
    9·2 answers
  • A water buffalo is born with slightly longer legs allowing it to run faster than the other water buffalo in the herd. This adapt
    9·2 answers
  • A student observed how many times bees visited each of four different colored roses. What would be the BEST way to visually comm
    12·1 answer
  • How are ethanol and glucose similar in structure and function?
    12·1 answer
  • How would you describe the process of two plates moving at a convergent plate boundary?
    10·1 answer
  • The Fresh Kills Landfill is in the process of becoming a park. Some of the leftover gas underneath the landfill will be burned f
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!