1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
asambeis [7]
3 years ago
15

5. Change the friction to the maximum amount.

Biology
1 answer:
Studentka2010 [4]3 years ago
4 0

Answer:

the answer is c

Explanation:

I hope this helped!

You might be interested in
Lymphocytes are specialized ________________cells.
meriva

lymphocytes are specialized T cell ,B cell, and natural killer cell .

these cells are distinguished from other lymphocytes by a protein on their surface known as the B cell receptor .these protein is specialized to recognize and attach to specific antigens.

7 0
2 years ago
In depression, anxiety is triggered by what neurotransmitter?
IRISSAK [1]

Answer:

option D: GABA ( gamma-aminobutyric acid )

Explanation:

The amount of neurotransmitters released during depression can not be properly measured. The neurotransmitters released due to anxiety are GABA, serotonin, Cck, and glutamate.

The rise in level of neurotransmitter, GABA in depression causes anxiety. Thus, option D is correct.

8 0
3 years ago
What are the effects of a change in protein? there is 3
Ksivusya [100]
Generally, mutations result in reduced protein function or no protein function. A mutation with reduced function is called a leaky mutation because some of the wild-type function “leaks” through into the phenotype. A mutation that results in no protein function is called a null mutation
4 0
2 years ago
How do actin and myosin work together to move a muscle?
Ratling [72]

Answer:

I don't know

Kwoeieu3iejdhd

3 0
2 years ago
Mastering biology Chapter 13 - Question 3 - Multiple Choice Homology is evidence of ________.
Fudgin [204]

Answer:

Homology is evidence Divergent Evolution

Explanation:

When we study DNA sequences from different species, we conclude that all the living organisms have been arise from a single common ancestor and due to homology between different species, it is also concluded that organisms now-a-days are a result of Divergent Evolution from a single common ancestor.

7 0
3 years ago
Other questions:
  • Describe two ways the United States could use resources more sustainably.
    12·2 answers
  • Identify the stage of mitosis where the sister chromatids separate and each daughter cell gets one chromosome.
    14·2 answers
  • Incomplete genetic linkage is far more common than complete linkage. What is the term for gametes produced when recombination sh
    13·1 answer
  • What are the divisions of geologic time?
    9·1 answer
  • Biology I (20 points)
    8·2 answers
  • what is projected to happen by 2050 , to some 200 to 600 million of the world poorest and most vulnerable people?.​
    5·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What cellular processes are going on during this time? Think back to the processes we have studied in this unit.
    6·1 answer
  • 2. Imagine a population of crabs living on a white sandy beach. The crabs ONLY occur in two colors- red and blue, each controlle
    13·1 answer
  • How many atp molecules are produced in the transition period during cellular respiration
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!