1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Taya2010 [7]
2 years ago
13

Which statement about the Aqua culture industry in the US is true

Biology
1 answer:
Vinil7 [7]2 years ago
5 0

Answer:

The true statement about the aquaculture is that It means “cultivating small acreages of land.”

You might be interested in
I need help please i don’t understand
Oxana [17]
The answer is the first one ( it has more protons than electrons)
6 0
2 years ago
if a homozygous dominant parent and a heterozygous parent are crossed, what percentage of the offspring are expected to be heter
Arada [10]
50%..................
8 0
3 years ago
The length and complexity of a food web in the arctic would be ____________ when compared to one in the tropical rainforest.
kumpel [21]

Answer:

Explanation:

yes

7 0
3 years ago
Should we not assume that just as the eye, hand, the foot, and in general each part of the body clearly has its own proper funct
MissTica
A man ie human is made up of their body parts the human mind is not separate from their body contrary to popular belief but is a mixture of chemicals.
To answer your question man is his parts.
8 0
3 years ago
Can somebody help me out with this question because I’m really confused??
egoroff_w [7]

epididymis-vas deferens-urethra

3 0
2 years ago
Other questions:
  • How can the cells in a multicellular organism differ from each other when they all have identical DNA
    6·2 answers
  • Who created the first accepted model of the atom?
    9·1 answer
  • Which autonomic nerve innervates the urinary bladder, uterus, and external genitalia?
    11·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How do mutations cause genetic variation?
    7·2 answers
  • What gland secretes estrogen
    6·1 answer
  • Write your list. Include the name of the object and if it is an insulator or conductor.
    13·1 answer
  • Which is correct according to dawinism?
    7·1 answer
  • Please answer I will give u brainliest
    13·1 answer
  • How do transposable elements and short tandem repeats (STRs) differ? a. STRs occur within exons; transposable elements occur wit
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!