1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
5

10. Explain why the feel of gypsum and talc can be used to distinguis between the minerals?

Biology
1 answer:
Shkiper50 [21]3 years ago
8 0
Talc has a score of 1, and gypsum has a score of 2, which makes these two minerals similar and difficult to differentiate between. Feel both pieces of rock for how slippery they are. If the rock is slippery, it may be talc. If the rock isn't slippery it may be gypsum.
You might be interested in
An organic will always contain
Naddik [55]

Answer:

Explanation:Compounds which have carbon and hydrogen atoms in their structure or formula are known as organic compounds. For example, a molecule of is organic because it has carbon and hydrogen atom in its formula. ... Thus, we can conclude that an organic molecule will always contain carbon and hydrogen

5 0
3 years ago
7. Glucose molecules are the building blocks of what
Zepler [3.9K]

Answer:

Proteins and Carbohydrates

Explanation:

5 0
2 years ago
Beaked whales feed at various depths, but they defecate at the ocean's surface. nitrogen-rich whale feces deposited in surface w
IgorC [24]
I think if the whale population decreased the surface fish populations would decline due to reduced populations of algae. This can be simply explained by the fact that, if the whale population is decreased, it means that the nitrogen rich feces that is supply nutrients to the algae would also decrease and therefore decrease the population of the algae and as a result the population of  of the surface fish  would also decline. 
3 0
3 years ago
A researcher is designing a laboratory experiment to determine whether the inorganic substance A affects the rate of a reaction
Bas_tet [7]
First, he should measure how long it takes for the liquid to become clear if X and Y are mixed together. Then, he should measure how long it takes if he also adds substance A to X and Y. He will find out if substance A is a catalyst. hope this helps :)
3 0
3 years ago
Read 2 more answers
The population of eukaryotic, heterotrophic organisms found near the surface of the ocean is called
Viktor [21]
Plankton

these are microscopic eukaryotic organisms the often float at the surface of the ocean
5 0
3 years ago
Other questions:
  • The choice of which material in the portrait group of tetrarchs speaks to imperial power?
    11·1 answer
  • What happens to the atmospheric temperatures when the carbon dioxide levels increase? Decrease?
    9·1 answer
  • Five body functions that monitor homeostasis
    11·1 answer
  • Steroid hormones are large communication molecules that are modified cholesterol molecules. How do you think they enter a cell?
    14·1 answer
  • In overhydration, what would be the levels of adh (high, normal, or low) and what would be the osmolarity of the urine?
    7·1 answer
  • What happens to the DNA in cell during interphase?
    8·2 answers
  • a model of the complex feeding interastiins among organism in a community from producer to decomposers called
    14·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • The giant african land snail is an invasive species that is also the largest snail ons earth what is most likely consequence of
    8·1 answer
  • 3. Base of a dame is made widey. why?​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!