1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fgiga [73]
3 years ago
8

GIVING OUT BRAINLIEST

Biology
1 answer:
Slav-nsk [51]3 years ago
3 0
Probably A the average amount of rain
You might be interested in
Wha is the answer to Oxygen enters the body through your what
WINSTONCH [101]
Mouth or nose. Then goes into your trachea and into your lungs
7 0
2 years ago
Read 2 more answers
What source of energy is ideal for prolonged, low- intensity activity
luda_lava [24]
Solar power because it is never ending and has no emmisions
5 0
3 years ago
Unlike DNA, RNA
Lisa [10]
<span>The answer is D. pairs uracil with adenosine instead of thymine. Through the process of elimination, both DNA and RNA contain nitrogenous bases. However, DNA contains sugar deoxyribose within its nucleotide components while RNA contains sugar ribose. Also, DNA has 2 strands wrapped in a helix while RNA has only 1 strand. Thus, the correct choice is D. because RNA pairs uracil with adenosine instead of thymine like DNA.</span>
7 0
3 years ago
Which us a main function of lipids​
otez555 [7]
Building blocks of cell membranes, insulation, cell communication, energy storage, protection
8 0
3 years ago
Which of the following best describes similarities that exist between reptiles and amphibians?. . They are both ectothermic and
Lynna [10]
"They are both vertebrates that lay eggs to reproduce" is the one among the following choices given in the question that <span>best describes similarities that exist between reptiles and amphibians. The correct option among all the options that are given in the question is the third option or the penultimate option. </span>
8 0
3 years ago
Read 2 more answers
Other questions:
  • You coat a Petri dish with fibronectin and proteoglycans and culture cells on the dish. The cells adhere to the dish. You repeat
    6·2 answers
  • Scientists suspect that modern horses have different dietary habits than horses that lived long ago. What is the most reliable s
    8·2 answers
  • Which protein is responsible for unraveling the DNA double-helix into 2 strands to prepare it for copying?
    11·1 answer
  • Which process tends to reduce variety within a population?
    15·1 answer
  • Nitrogen-fixing bacteria convert atmospheric nitrogen into forms of nitrogen that living things can use.
    7·1 answer
  • Which of the following specifies a single amino acid in a polypeptide chain?
    13·1 answer
  • A person develops a disease in which her immune system attacks her own connective tissue. Where would this disease have the grea
    15·1 answer
  • When an atom loses electrons, it becomes positively charged.
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • A mutualistic relationship in which either species can survive without its partner is called a ________ mutualism.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!