1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ankoles [38]
3 years ago
12

The atomic number, of an element, indicates​

Biology
2 answers:
Vinil7 [7]3 years ago
7 0
The number of protons in the nucleus of the atom.
lutik1710 [3]3 years ago
6 0

Answer:

The symbol for an atom can be written to show its mass number at the top, and its atomic number at the bottom. To calculate the numbers of subatomic particles in an atom, use its atomic number and mass number: number of protons = atomic number. number of electrons = atomic number.

You might be interested in
This is science <br> the question is what caused the jelly population to increase.
vampirchik [111]

Answer:

When the walleye pollock population decreased, there were more zooplankton available for the moon jellies to eat. Since the jellies had more energy storage molecules, they were able to reproduce more. This lead to more births than deaths in the moon jelly population, which caused the jelly population to increase.

Explanation:

here

7 0
2 years ago
Read 2 more answers
The sleep like state which an animal adopt to lower metabolic rates is called
vivado [14]
Heyy :))

The best answer would be:
<span>Hibernating

I hope this helps!
Good day :D</span>
3 0
3 years ago
Which is an example of a negative effect of technology?
Virty [35]
Causes kids to not know how to communicate face to face
7 0
3 years ago
How can natural selection affect a predator-prey relationship in an ecosystem? Choose all answers that are correct.
yanalaym [24]
B and C are correct - A is incorrect as natural selection affects any generation of species. D is also incorrect as any species population change in an ecosystem inevitably affects another, even if it isn't a predator-prey relationship.
8 0
3 years ago
Question 8<br> The ribosomal RNA connects the amino acid to the codon.<br> True<br> O False
Elis [28]
The answer for that is false
8 0
3 years ago
Other questions:
  • Smog complex is: an atmospheric condition during which a warm layer of air stalls above a cool layer the precipitation of acidic
    14·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Plants and animals do not respond to the pressure of abiotic factors in their ecosystems
    14·2 answers
  • How does meat consumption affect human population
    5·1 answer
  • Which of the following is a major problem with using geothermal?
    12·2 answers
  • An anode is an electrode immersed in the half-cell where _____ takes place.
    5·1 answer
  • Trees planted on hills keep lakes + streams from becoming muddy how?
    10·1 answer
  • How do animals and humans cause erosion ?​
    15·2 answers
  • I´ll give brainliest to the correct and most helpful answer!
    5·2 answers
  • For brainly !! <br><br> Give an example of seedless vascular plants
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!