1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dvinal [7]
3 years ago
7

What is the cell membrane made of? Check all that apply.

Biology
2 answers:
hram777 [196]3 years ago
6 0
I’m not to sure about this
chase2 years ago
0 0

Proteins, lipids,carbohydrates

You might be interested in
Which nursing actions are necessary to prepare a perinatal patient for research?
Bezzdna [24]
The necessary actions are 
<span>- Inform the patient about her rights
</span><span>- Obtain consent from the patient
</span>
To be ethical, we should fully give informations to the perinatal patient about research without concealing anything. Including the potential side effects of the research and the payment/benefit that they patients would get if they agree to be a part of it
6 0
3 years ago
You have a plant with yellow seeds, which express a dominant phenotype. How would you determine the plant's genotype? Conduct a
Archy [21]
The answer is <span>Conduct a test cross with a purebred recessive plant. 

</span>

Test cross is the cross between an organism with unknown dominant genotype and an organism with known recessive genotype.

<span>Since dominant trait results from a dominant allele, the test cross can determine if an unknown genotype is heterozygous and homozygous dominant. </span>

If A is dominant allele, and a is recessive allele, then AA is dominant homozygote, Aa is a heterozygote, and aa is recessive homozygote.

<span>According to the Punnett square, if all of the offspring are heterozygote (Aa), then unknown genotype is dominant homozygous (AA). If half of the offspring are the heterozygote, and the other half are recessive homozygote, then the unknown genotype is heterozygote (Aa).</span>

6 0
3 years ago
An elderly client newly diagnosed with systolic hypertension asks her health care provider why this happens. which response is m
Roman55 [17]
The response that is most accurate is that; with age, your arteries lose their elasticity and are replaced with collagen, which makes your arteries stiffer. Systolic hypertension or pressure is an elevated systolic blood pressure. If the systolic blood pressure is elevated (above 140) with a normal (<90) diastolic blood pressure, it is called the isolated systolic hypertension. 
3 0
3 years ago
What is definition of biotechnology
lora16 [44]
The exploitation of biological processes for industrial and other purposes especially the genetic manipulation of microorganisms for the production of antibiotics , hormones, ETC
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • 1) What evidence is there that the human species has been successful so far? Explain.
    11·1 answer
  • How much is the increase in temperature from 1880 to 2010
    10·1 answer
  • The only group with an endoskeleton is
    8·1 answer
  • Unlike cones, rods ?
    14·1 answer
  • Which of these infectious, viral diseases affects the immune system and can cause major damage to organs such as the liver and b
    10·1 answer
  • 'erms: DNA, budding, male and female, one parent, unique, spores, uniform, traits, egg, and
    6·1 answer
  • Brown eyes (B) is dominant to blue eyes (b). What are the chances of two
    12·1 answer
  • HELP ASSAAAPPPP PLEASE
    9·2 answers
  • How do I get rid of these when watching a video
    5·1 answer
  • Name the cavity between the nose and mouth.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!