1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
8

According to cell theory, how is hereditary information transmitted?

Biology
1 answer:
levacccp [35]3 years ago
7 0

Answer:

It is passed from old cells to new cells during cell division.

Explanation:

Cell theory states that DNA is passed between cells during cell division

You might be interested in
Which of the following is an example of an abiotic. factor
ivanzaharov [21]
Abiotic factors are factors that are not caused by the activities of living organism
examples rain, wind, temperature and sunlight
8 0
3 years ago
Which is a reason cells divide? for apex learning
rosijanka [135]

Answer:

A. To reproduce

Explanation:

Cells divide in two stages: Meiosis - haploid cell division [½ number of chromosomes], and Mitosis - diploid cell division [same number of chromosomes]. Their objective is to produce offspring, which means reproduce.

I am joyous to help. Anytime.

6 0
3 years ago
Read 2 more answers
NPK fertilizer are added in the soil to fulfill the need of ________​
lisov135 [29]

Answer:

Fertilizer is added to soils to increase plant productivity. A common type of fertilizer is called NPK fertilizer because of its ingredients: nitrogen (N), phosphorus (P), and potassium (K).

Explanation:

3 0
2 years ago
Read 2 more answers
Most fungi are saprobes. What does this mean?
svp [43]
They feed on dead, decaying, organic matter.
6 0
3 years ago
Critical thinking is the ability to reason and solve problems using facts and concepts. These questions can be approached from a
Aleksandr [31]

Answer:

Yeast

Explanation:

The correct answer would be yeast.

Yeast belongs to the fungi kingdom. Organisms in the fungi kingdom are generally eukaryotic in that their cells contain a nucleus and membrane-bound organelles such as mitochondrion. Fungal cells lack chlorophyll and are therefore nonphotosynthetic. They are also nonmotile

<em>While fungi exhibit different body forms in terms of body complexity, the only unicellular form is yeast. The organism possesses all the attributes of fungi highlighted above, has a cell wall made largely of chitin, and reproduces through budding. </em>

3 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • During which stage of postmortem decomposition does the body become bloated with gas
    7·2 answers
  • Now, suppose Lauren wants to buy exactly 2 bracelets and 2 other pieces of jewelry. There are ways to select 2 bracelets. There
    12·1 answer
  • Bacteria were first observed in 1903. True False
    10·1 answer
  • Why do you think that some bacteria/diseases are harder to eradicate than others?
    12·1 answer
  • The most efficient energy-liberating process
    12·1 answer
  • Which processes relate to mechanical weathering check all that apply
    6·2 answers
  • Which of the following organisms will be connected to primary consumers in a food web?
    5·2 answers
  • Please help<br> question is in photo
    7·1 answer
  • I like to see the answers
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!