Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
The correct answer would be D. Sepals and Petals.
<span>Ss, Ss, ss, ss will the genotypes formed
So your an
answer is B
hope i helped ;)</span>
In some protists, genetic information is transferred from one cell to the next. This transfer is called Internal fertilization
Hope this helps!
-Payshence xoxo
People with schizo who have enlarged ventricles are less responsive to medications (as women have been proven less likely to have enlarged ventricles with schizo, volume in the prefrontal areas of the brain actually decreases, and there are much more severe symptoms do to loss of brain matter.)