1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
g100num [7]
3 years ago
13

Question 5 of 30 Which statement provides the best description of the relationship between primary consumers and producers? O A.

Producers and primary consumers compete with each other for food sources. B. Primary consumers eat secondary consumers, which rely on producers for food. C. Producers provide primary consumers with the chemical energy they need. D. Primary consumers provide producers with the chemical energy they need.​
Biology
1 answer:
Vanyuwa [196]3 years ago
8 0

Explanation:

producers? O A. Producers and primary consumers compete with each other for food sources. B. Primary consumers eat secondary consumers, which rely on producers for food. C. Producers provide primary consumers with the chemical energy they need. D. Primary consumers provide producers with the chemical energy

You might be interested in
Why is the cycling of matter important to life on earth?
german

Answer:

It needs to have it

Explanation:

Earth is earth

6 0
3 years ago
Energy in organisms is called what?
Georgia [21]
Energy in organisms is called ATP (specifically energy in the cell). I hope I helped!
3 0
3 years ago
Read 2 more answers
Which big cat is most aggressive and dangerous?
12345 [234]
Lion is the most dangerous cat
6 0
4 years ago
How does solar radiation work within an actual greenhouse?
kondaur [170]

Answer:

The absorbed heat energy is then emitted as infrared radiation by the plants and soil. The greenhouse's glass absorbs the ultraviolet radiation and reflects some of it back into the greenhouse, maintaining the greenhouse warm although the outside temperature drops.

your welcome! :)

4 0
3 years ago
Which traits are characteristic of multicellular organisms? Choose all answers that are correct. A. can reproduce a whole colony
sammy [17]
<em>The traits of multicellular organisms are A. Can reproduce a whole colony in a matter of hours. and D. Divide in two to produce.</em>
4 0
4 years ago
Other questions:
  • Imagine your soil is basic, with a pH of 8.5. In soils with a high pH, minerals like iron, manganese, and phosphorus are less av
    15·1 answer
  • In most terrestrial and many aquatic ecosystems, the _____ food chain is the dominant pathway of energy flow
    9·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • 1.Scientists in a lab are working on a series of experiments that involve colliding two or more atomic nuclei at very high speed
    10·2 answers
  • What happens at the very end of mitosis
    15·1 answer
  • Ayurvedic medicine and naturopathy, what are they?
    15·1 answer
  • What are Krebs cycle inputs and outputs?
    5·1 answer
  • What is the material all about ?​
    6·1 answer
  • DNA is considered the blueprint of life, yet in eukaryotic organisms, such as humans, DNA never leaves the nucleus. Which of the
    14·1 answer
  • How does the conservation of matter relate to the process of digestion?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!