1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
3 years ago
12

Name the phase:Hint: Chromosomes are moving apart.​

Biology
1 answer:
umka2103 [35]3 years ago
5 0

Answer:

Mitosis it's the Anaphase

when the spindle fibres contract, each chromosome splits at the centromere, and its two chromatids are pulled apart towards opposite ends of the cell. Each chromatids is actually a single stranded chromosome, since DNA replication took place

You might be interested in
Please help me. No links and please don’t search this I tried it. The answer doesn’t make sense so yah. I Well mark brainliest
Tasya [4]

Answer:I searched it up but i did understand it, it said something bout how they would not be able to service cuz I think the might lose food or something like that and just from my opinion they are supposed to live in the cold I don’t think they’ll be able to survive the hotness.

Explanation:

5 0
3 years ago
To make your home a safe environment,_______ measures need to be taken on a moment-by moment basis.To make your home a safe envi
seraphim [82]
<span>preventive is what you're looking for</span>
4 0
3 years ago
Read 2 more answers
Why can oxygen gas, and carbon dioxide gas, CO2 , move through the cell membrane?
erastova [34]
Carbon dioxide and oxygen are two molecules that undergo this simple diffusion through the membrane.
7 0
3 years ago
Read 2 more answers
Some isotopes are_____ , which makes them suitable for medical imaging procedures.
Darina [25.2K]
Some isotopes are radioactive, which makes them suitable for medical imaging procedures. Radioactive isotopes have found a wide range of use in medicine. For example, they are used as tracers for diagnostic as well as research on metabolic processes. They are also used in medical imaging procedures, these isotopes include fluorine-18, gallium-67 among many others.
4 0
3 years ago
Read 2 more answers
Which of the following is a direct result of antidiuretic hormone?
ElenaW [278]

Answer: Option A.

Decreased urine volume.

Explanation:

The direct result of antidiuretic hormone is decreased urine volume because it is the hormone secreted by the hypothalamus of the the brain and stored pituitary gland which control blood pressure and make the kidneys to release less water, as little water is released by the kidneys, there will be little amount of urine produced.

This hormone reduce the urine volume or amount of urine produced.

7 0
3 years ago
Other questions:
  • A native american adult is hospitalized. the emergency department assessment indicates auditory and visual hallucinations. the c
    12·1 answer
  • What is an ecological system called that consists of all of its biotic and abiotic factors?
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which widely used system of government did ancient Greece contribute to the modern world? A. democracy B. monarchy C. republican
    6·2 answers
  • Which condition can cause a population crash?
    11·1 answer
  • Which of the following does not occur during mitosis?
    6·2 answers
  • Santa Claus and Mrs. Claus are expecting a little bundle of joy soon. Santa Claus is homozygous for good vision. Mrs Claus is ne
    13·1 answer
  • The graph provided shows the change in size of four populations introduced into a new habitat. Which population was the first to
    6·1 answer
  • How does the fossil record support the evolutionary theory?
    13·1 answer
  • Plant cells make protein
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!