1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shusha [124]
2 years ago
13

(I NEED THIS ASAP PLEASE) How are the processes of meiosis I and meiosis II different?

Biology
2 answers:
Brrunno [24]2 years ago
5 0

In meiosis I, homologous chromosomes separate, while in meiosis II, sister chromatids separate. Meiosis II produces 4 haploid daughter cells, whereas meiosis I produces 2 diploid daughter cells. Genetic recombination (crossing over) only occurs in meiosis I. D

MaRussiya [10]2 years ago
5 0

Answer:

A. Meiosis I results in two genetically unique haploid cells, while meiosis II results in four diploid cells that are genetically identical

You might be interested in
Energy is transferred between the atmosphere and hydrosphere by which two processes?
Dafna1 [17]
The answer is condensation and evaporation.
4 0
3 years ago
Read 2 more answers
How does oxygen move from the respiratory system to the circulatory system?
TEA [102]

the right answer is by diffusion across a capillary wall

5 0
3 years ago
Read 2 more answers
The graphs here show the distribution of beak depths for the ground
dedylja [7]

Answer: (A) Natural selection tend to reduce genetic variation as there was a smaller distribution of beak depths, but it tends to select for the most fit phenotypes, as there was an increase in average beak depth after the drought.

Explanation: The picture below shows proof if needed. On USATP

5 0
2 years ago
During the cell cycle, the cell replicates dna. This step occurs.
allochka39001 [22]
DNA is replicated during the “S” phase (synthesis).
5 0
2 years ago
Cells can interact with other cells?
Allisa [31]

Answer:

Yes. Cells have 'cell receptors' that are used to receive messengers like hormones to communicate. Cell receptors have specific shapes that fit the shape of the messenger that they want to receive. Organs like the pancreas send our these messengers to the cells to order them to do different functions.

3 0
3 years ago
Other questions:
  • What is the second step of the scientific method
    8·1 answer
  • The red-cockaded woodpecker, an endangered species, is dependent upon __________ for maintenance of its source habitat
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Select all the correct labels on the image.
    7·2 answers
  • Which action causes breakers​
    12·1 answer
  • Polymerase chain reaction (PCR) is a technique used to amplify (copy) DNA. Suppose a single, linear molecule of double‑stranded
    7·1 answer
  • Color blindness is a recessive sex linked disorder in which the proteins that absorbs red and green light in the eye do not work
    5·1 answer
  • Is electricity a "green " energy resource ? Explain why or why not.
    11·1 answer
  • What was the result of using drainage blocks to keep water in the field level during the growing season?
    9·1 answer
  • Why are hydrogen atoms different from the atoms of all other atoms
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!