1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ziro4ka [17]
3 years ago
15

The Law of Independent Assortment states that the inheritance of one trait does not influence the inheritance of any other trait

. Use the Law of Independent Assortment to explain why the kittens have the coat and eye colors they have?
Biology
1 answer:
fgiga [73]3 years ago
5 0

Answer:

Answer:The Law of Independent Assortment, also known as or Mendel's Second Law, states that the inheritance of one trait will not affect the inheritance of another.

You might be interested in
A birds newly grown feathers are called?
11Alexandr11 [23.1K]
Vaned feathers maybe?

5 0
3 years ago
Write a paragraph that includes all of the above: bats, c o v i d 19, corona viruses, colds, crown, respiratory, SARS CoV 2, spi
r-ruslan [8.4K]

I like the word bats. It is cool. I also like the world "c o v i d 19" and "coronaviruses". I live getting colds cuz my mother treats me like her queen and puts a crown on my head. I am suffering from respiratory malfunction so please donate to my gofundme. Sars CoV 2 sucks. I spill over my shirt- NOOO! I go to the zoo for "zoo nosis" and then I sleep.

3 0
3 years ago
How can you get fat from eating too many carbohydrates
lbvjy [14]
If you don't use them they get stored as glycogen, for later use. buy if you're not active, it can lead to obesity.
5 0
3 years ago
_______ is often preceded by a "crash" since the growing population eventually is too large for the available resources.
vovikov84 [41]
<span>Stability is often preceded by a "crash" since the growing population eventually is too large for the available resources.
Stability refers to population stability. The growth of the population may destabilize the population stability.
The population size may become so large, so there will be no enough resources for species to survive. </span>
8 0
3 years ago
Enzymes what do they do? what are they made of? how do they work?
MatroZZZ [7]
<span>To break a protein down into its amino acids you will need enzymes. Enzymes are biological molecules (proteins) that act as catalysts and help complex reactions occur everywhere in life. Let's say you ate a piece of meat. Proteases would go to work and help break down the peptide bonds between the amino acids.

</span>
5 0
3 years ago
Other questions:
  • What is a population? How do different populations affect one another?
    6·1 answer
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • A pregnant woman (first trimester is concerned that she has been exposed to a chemical that blocks estrogen and progesterone rec
    8·1 answer
  • The chemical digestion of food is dependent on a whole range of hydrolase enzymes produced mostly by the cells lining the gut as
    14·2 answers
  • Which of the following best completes the hypothesis?
    11·2 answers
  • In the biogeochemical cycle for carbon, the same atoms of this element are moved and recycled around the planet through which sp
    7·2 answers
  • Which word defines the group of all penguins living together in one area?
    11·1 answer
  • What is one possible positive outcome of global warming?
    8·1 answer
  • Are all animals that share a food source classified in the same trophic level
    6·2 answers
  • Please help. Where do they go? And which for #5?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!