1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin2010 [14]
4 years ago
5

This primate lives in the grassy highlands of Eastern Africa. It has arms and legs that are relatively equal in length and a sho

rt tail. Its bilophodont molars have relatively large shearing cusps, and it has a large mandible. This primate is female, but males of her species have dramatically larger bodies and canine teeth than females. Males also have a lot of extra fur around their chests and heads that isn’t seen in females. What is the likely diet of this primate? Give one trait that supports your determination.
Biology
1 answer:
Serga [27]4 years ago
4 0

Answer:

On the basis of the given information, that is, the ape exhibiting small incisors and biphodant molars, shows that they generally consume fruits and seeds as the prime part of their diet. Thus, mainly the apes feed on fruits, leaves, and seeds, thus it makes them vegetarian.  

However, it has also been observed that canine teeth are found in both males and females, though they are larger in males. This shows that apes can consume meat from small birds and animals occasionally.  

You might be interested in
Organisms need nutrients in order to
Anarel [89]
Organisms need nutrients to b. carry out essential life functions
5 0
4 years ago
A family has two male children. one brother has a straight thumb, while the other brother has a bent thumb. What causes this dif
dalvyx [7]
The parents had two recessive traits for a bent thumb.
6 0
3 years ago
Read 2 more answers
Explain how the structure of epithelium and the structure of connective tissue, specifically bone, relate to the function of the
Aneli [31]
<span>Epithelial tissue is densely packed cells that used most in the area where protection is needed. This cells mostly used in skin, some with more keratin which will increase their ability to protect. In bone, the main protective layer is calcium mineral which was deposited by osteocytes. Because this bone doesn't really need more epithelial cells. Bone tissue only needs a good vascularization and connective tissue to support it.
</span>
7 0
3 years ago
Read 2 more answers
4/5 + 2/3 equals what
BigorU [14]

Hey there!

We need to find a common denominator.

5*3= 15

4/5= 12/15

2/3= 10/15

12+10=22

22/15

or

1 7/15

I hope this helps!

~kaikers

7 0
3 years ago
Read 2 more answers
PLZ HELPED IM TIMED14 Photosynthesis and cellular respiration are two processes that help drive Earth's carbon
andreev551 [17]

Answer: C). Photosynthesis depends on the presence of carbon dioxide.

Explanation: Photosynthesis is a process by which green plants use chlorophyll to manufacture their own food in the presence of carbon dioxide, water and sunlight. The products of photosynthesis are glucose and oxygen.

5 0
4 years ago
Other questions:
  • What pieces of equipment are needed to calculate the velocity of a falling object?
    5·2 answers
  • Which of the following is not a key advantage provided by the exoskeleton of terrestrial arthropods?
    9·1 answer
  • Hand passing sharps is a safe practice is this statement
    13·2 answers
  • Anything in an organism's environment that causes it to react is called a ___. Is it a home or stimulus?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Es - Which group of animals was the first to adapt to life on land by developing large lungs, eggs with a waterproof shell, and
    11·2 answers
  • Anong kahulugan at kasingkahulugan ng nakakaririwasa ​
    14·1 answer
  • What is the purpose or function for ectoplasm in biology
    9·1 answer
  • Why is global warming dangerous?
    10·2 answers
  • The process by which modern organisms have descended from ancient organisms is called.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!