1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
12

Question 1 (1 point) Which concept was NOT included in Charles Darwin's theory of natural selection?

Biology
1 answer:
hammer [34]3 years ago
5 0

I'm pretty sure its C the punctuated equilibrium

Because its the only non-natural odd one out of everything based off survival

You might be interested in
What are the areas of the body that can be used to obtain body temperature?
Virty [35]
<span>oral,under arm,rectal,forehead</span>
6 0
3 years ago
How can a compass be used to determine if an electromagnet is working?
Kryger [21]
The answer should be B.
3 0
3 years ago
What is the smallest taxonomic group that contains organisms of different species?
Vladimir79 [104]
Answer: Genus
From largest to smallest, the pyramid of binomial nomenclature goes: kingdom, phylum, class, order, family, genus, species.
8 0
3 years ago
All are parts of an ATP molecule except for?
andreyandreev [35.5K]

Answer:

chlorophyll

Explanation:

What are the three parts of an ATP molecule?  

adenine, ribose, and three phosphate groups

6 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
Other questions:
  • Which of these descriptions involves an example of a nonrenewable resource?
    12·2 answers
  • Which cell organelle helps the plant maintain it's structure during such stress
    15·1 answer
  • Which of the following processes and organelles account for the replacement of lipids and proteins lost from the plasma membrane
    10·1 answer
  • The presence of freckles is due to a dominant allele. four percent of the individuals in a particular population lack freckles.
    14·2 answers
  • what is it called when a scientists personal opinion affects the way experimental results are reported A. bias B. curiousity C.
    9·2 answers
  • The scientist who proposed the idea of continental drift was _____. Albert Einstein Carl Hubbell James Watson Alfred Wegener
    6·2 answers
  • What is the relationship between Distance and average number of species?
    11·1 answer
  • In Asia, human population growth and land development have fragmented forest habitats. Because of this fragmentation, tigers hav
    8·1 answer
  • Please answer the question in 20 minutes thanks!!!!
    11·1 answer
  • The appearance or quality of light reflected from the surface of a mineral is known as ________.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!