Answer:
UUUUUUAAAAAAGGGCCCCAAAUAUAUAG
Explanation:
All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)
This lesson is about producers and consumers<span> in the </span>tropical rainforest<span>. ... Even the rubber on our tires comes from </span>rubber trees<span> growing in the Amazon. ... Primary </span>consumers eat<span> only producers; secondary </span>consumers eat<span> primary </span>consumers<span>; .
</span>
Glycolysis is the correct answer
Bryophytes, an informal group that is now treated as three separate land plant Divisions, namely Bryophyta (mosses), Marchantiophyta (liverworts), and Anthocerotophyta (hornworts).
Answer:
DNA floats free within the cytoplasm and is not enclosed within a nuclear envelope, whereas eukaryotic DNA is enclosed in a membrane-bound structure known as the nucleus.
