1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
5

Can you curl your tongue? Tongue-curling in humans (T) is a dominant genetic Derek can curl his tongue but his wife. Ashley, can

notAll nine of their children can curl their tongues. Complete the Punnett square based on the genotypes they most likely have.
Biology
1 answer:
Vladimir79 [104]3 years ago
3 0

Answer:

yes, i can. I can also make a 'w' with my tongue

Explanation:

You might be interested in
What rock layer is older then Loess.
laila [671]

Answer:

Loveland Loess

Explanation:

5 0
3 years ago
Read 2 more answers
How do oceanographers use their measurements of the conductivity of seawater?
dmitriy555 [2]

To calculate the water's salinity

by Elena

6 0
3 years ago
Read 2 more answers
Please help me<br>I will give you 10 points and don't answer it wrong please <br>​
sveta [45]

Answer:

virus

Explanation:

Virus is the correct answer

4 0
3 years ago
Read 2 more answers
What observations were you able to make after 24 hours? 48 hours?
elena55 [62]
Observations about what?
5 0
4 years ago
Read 2 more answers
Tiny sacs in the lungs where oxygen exchange takes place. fundamental working unit of the nervous system. sometimes called the m
lbvjy [14]
The answer for the first one would be the Alveoli 

the second one is the pituitary gland
5 0
3 years ago
Other questions:
  • The muscular system helps maintain body temperature. Explain why humans shiver in the cold. Be sure to discuss the process of ce
    9·1 answer
  • Single sugar molecules are also called?
    9·2 answers
  • Think about the volume of the stack. By definition, what is the volume of the stack equal to? Express you answer in words instea
    5·1 answer
  • The major divisions of the peripheral nervous system are the ____.
    14·1 answer
  • A cell from a heart muscle would probably have a high proportion of what?​
    15·1 answer
  • One factor that can increase sensitivity to sunlight is genetics.<br> a. True<br> b. False
    11·1 answer
  • According to Newton’s third law of motion, which of the following best describes the forces of the tennis racket and the ball?
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which factor does not affect the amount of water that can be stored in the ground?
    12·1 answer
  • Using Punnett Squares, determine the percentage of offspring which would be heterozygous from the following cross: BB x bb
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!