1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nonamiya [84]
3 years ago
13

Guys plsssss help me

Biology
2 answers:
Andrews [41]3 years ago
8 0

Answer: A

Explanation:1 this is 4th grade work

HACTEHA [7]3 years ago
4 0
The answer would be A I hope this helps
You might be interested in
On the Celsius scale, the boiling point of water is_?
Taya2010 [7]
The boiling point of water is c. 100 degrees
4 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Granite rock is light in color. Which feature directly contributes to this color?
kondaur [170]

Answer: the amount of silica minerals in granite

Explanation:

Usually, 70-77 percent silica, 11-13 percent alumina, 3-5 percent potassium oxide, 3-5 percent soda, 1 percent lime, 2-3 percent total iron, and less than 1 percent magnesia and titania are the chemical composition of granite. Rhyolite is another kind of volcanic rock with a similar or equivalent chemical composition and mineralogy. Due to high precense of silica the color of granite appears lighter.

3 0
2 years ago
Read 2 more answers
How is a cell a system , ANWSER IN YOUR OWN WORDS ?
-BARSIC- [3]

Explanation: the movement of organelles and other substances within cells. Endoplasmic reticulum

5 0
3 years ago
Choose the definition of: invertebrates
slega [8]
<span>Invertebrates means having no backbone.</span>
7 0
2 years ago
Other questions:
  • Explain why you can't fully test the lipase activity in tube 5.
    9·2 answers
  • This question is based on the experiment that identified the role of the origin of replication using bacteria and a plasmid. the
    7·1 answer
  • Which statement best describes the relationship between photosynthesis and cellular respiration
    5·1 answer
  • A few students want to live healthier lifestyles. They decide to use one of the following vegetable oils for cooking.
    6·2 answers
  • From the point of view of your immune system, what is the most likely consequence of picking your nose?
    10·2 answers
  • Pleasssss help <br>This is also due today
    13·1 answer
  • Create a personal plan of preventative health and dental management. What steps can you take to maintain your health and wellnes
    14·2 answers
  • Which of the following answer choices best explains what process lead to each cells' unique structures
    8·1 answer
  • Problem 10.23 in book: There are 3.4 billion base pairs lined up end to end in one human DNA molecule, which contains the entire
    5·1 answer
  • Explain why plants with normal leaves grow more than plants with variegated leaves.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!